Chester Clinic

 

Gutierrez-et-al-2011-jbc-rev-02

JBC Papers in Press. Published on May 31, 2011 as Manuscript M111.253674
OPTOGENETIC CONTROL OF MOTOR COORDINATION BY Gi/o PROTEIN-COUPLED
VERTEBRATE RHODOPSIN IN CEREBELLAR PURKINJE CELLS.
Davina V. Gutierrez2, Melanie D. Mark1, Olivia Masseck1, Takashi Maejima1, Denise Kuckelsberg1,
Robert A. Hyde2, Martin Krause1, Wolfgang Kruse1, and Stefan Herlitze1,2
From the 1Department of Zoology and Neurobiology, ND7/31, Ruhr-University Bochum, Universitätsstr. 150, D-44780 Bochum, Germany; 2Department of Neurosciences, Case Western Reserve University,
10900 Euclid Avenue, Cleveland, OH 44106-4975, USA. Running head: Expression of vertebrate rhodopsin in Purkinje cells Address correspondence to: Stefan Herlitze; Department of Zoology and Neurobiology, ND 7/31, Ruhr- University Bochum, Universitätsstr. 150, D-44780 Bochum, Germany Phone: +49 234 32 25607 Fax:+49 234 32 14185 Email: [email protected]
G protein-coupled receptors (GPCRs) are
inhibiting more or less specifically a certain involved in the modulation of complex
GPCR pathway. Recently, we demonstrated that neuronal networks in the brain. In order to
light-activated vertebrate rhodopsin (vRh) is a investigate the impact of a cell-specific Gi/o
suitable alternative to control ion conductances protein-mediated signalling pathway on brain
such as G protein-coupled inward rectifying K+ function, we created a new optogenetic mouse
channel (GIRK) and voltage-gated Ca2+ model in which the Gi/o protein-coupled
channels via pertussis toxin-sensitive Gi/o receptor vertebrate rhodopsin (vRh) can be
protein-mediated signaling (3). Therefore, vRh cell-specifically expressed with the aid of Cre
may allow for the precise spatio-temporal recombinase. Here we use this mouse model
control of Gi/o-mediated pathway in vivo, leading to study the functional impact of Gi/o
to an investigation that focuses on the function modulation in cerebellar Purkinje cells (PC).
of this pathway in animal behavior or brain We show that in vivo light activation of vRh
functions such as motor coordination. specifically expressed in PCs reduces simple
The cerebellum plays a central role in spike firing that is comparable to the
overall motor coordination and motor learning. reduction in firing observed for the activation
An extensive array of GPCRs are expressed of cerebellar Gi/o-coupled GABAB receptors.
throughout the brain and are believed to be Notably, the light exposure of the cerebellar
involved in the modulation of network activity vermis in freely moving mice changes the
and synaptic plasticity. It has been recognized motor behavior. Thus, our studies directly
that the code for motor coordination and balance demonstrate that spike modulation via Gi/o-
lies within the firing cadence and output pattern mediated signalling in cerebellar PCs affects
of cerebellar PCs, which are the sole-output motor coordination and show a new
neurons from the cerebellar cortex (4,5). PCs promising approach for studying the
integrate a range of cortical, vestibular and physiological function of GPCR-mediated
sensory information via excitatory synaptic input signalling in a cell-type specific manner.
from parallel and climbing fiber pathways and inhibitory synaptic input originating from The G protein-mediated signalling pathway neighboring interneurons. The PC firing pattern provides a pivotal module for the adjustment of is determined by several factors that include, the neuronal networks against physiological or interplay between excitatory and inhibitory behavioral tasks on a second to minute time scale (1). Among G-proteins, the Gi/o-mediated conductances that support intrinsic firing signalling pathway is the primary role in which properties and modulation by postsynaptic GPCRs mediate their inhibitory action on GPCRs like the GABAB receptor (GABABR) (6- neuronal excitability (2). The processes and 8). GABABR activation by application of the importance of such modulation in cellular and selective agonist baclofen, leads to a reduction network functions has mainly been investigated in PC firing most likely due to membrane with the application of drugs, activating or hyperpolarization induced by GIRK channel Copyright 2011 by The American Society for Biochemistry and Molecular Biology, Inc.
activation (9-12). The exact mechanism in which conditions: 92oC for 30 s, 60oC for 45 s and Gi/o mediated GPCR modulation may occur 72oC for 1 min run for 40 cycles or 95oC for 30 within PCs and how such modulation may s, 55oC for 1 min and 72oC for 1 min 30 sec for influence the single spike pattern and motor 40 cycles to detect vRh-GFP or Cre- coordination has been difficult to address in Recombinase respectively. PCR products were vivo, since GABABRs and other Gi/o coupled analyzed on a 1% agarose gel utilizing standard receptors are expressed in various cell-types in the cerebellum and can only be activated by identified vRh-GFPPC mice expressed both the slowly diffusing drugs. vRh and Cre recombinase genes. Wild type In order to overcome the kinetic and littermates were distinguished as being negative spatial issues that the pharmacological approach for either vRh or Cre recombinase or both. presents and to investigate the functional impact β-Galactosidase Staining- Animals
of Gi/o protein-mediated modulation on were deeply anaesthetized with 0.2cc/g Avertin cerebellar function via spike modulation in (tribromoethanol; Sigma) and transcardially cerebellar PCs, we created an optogenetic mouse perfused with 1X PBS followed by a neutral model for the cell-type specific expression of vRh and demonstrated that spike modulation of paraformaldehyde). Upon complete perfusion, PCs affects motor cordination. brains were isolated and post-fixed in the same paraformaldehyde solution for 15 minutes. EXPERIMENTAL PROCEDURES
Frozen, embedded brains (OCT, Tissue TEK) were cut into 25-30 micron section on a rotary Generation and Screening of transgenic Mice-
microtome, mounted onto Superfrost/Plus In order to generate a colony of vRh-GFPPC Microscope Slides (Fisher), allowed to dry at room temperature for 1 hour and permeabilized Purkinje cell specific CRE (TgPcp2-cre) mice (13) with PBST (0.2% Triton X-100) for 15 minutes. Slices were incubated overnight with 1mg/ml X- GFP(TgflvRh-GFP) mice. Routine screening of all gal staining solution (200 mM ferricyanate; transgenic mice was accomplished by adding Sigma, 200 mM ferrocyanate; Sigma, X-gal (40 either tail or toe tissue to 0.3 ml of lysis buffer mg/ml in DMSO); Sigma, 1 M MgCl2; Sigma, containing 100 mM Tris (pH 8.5), 5 mM EDTA 0.02% NP40; Sigma, and 1X PBS) at 37oC in a (disodium salt), 0.2% SDS and 200 mM NaCl. Twenty microliters of proteinase K (20 mg/ml, Immunohistochemistry- Animals were
Roche Diagnostics) was added to the lysis buffer deeply anaesthetized with 0.2cc/g Avertin and the mixture was shaken overnight at 55oC. (tribromoethanol; Sigma) and transcardially Following tissue dissolution, the mixture was perfused with 1X PBS followed by a neutral heated to 99oC for 10 minutes and then cooled to room temperature. A PCR master mix contained paraformaldehyde). Upon complete perfusion, either of the following oligos: vRh-GFP (5' brains were isolated and post-fixed in the same CATGCTCACCACCGTCTGCT paraformaldehyde solution for 1 hour followed AAGATGGTGCGCTCCTGGAC) by a 30% sucrose solution for 24-48 hours. Frozen, embedded brains (OCT, Tissue TEK) TCTCACGTACTGACGGTGG were cut into 25-30 micron section on a rotary ACCAGCTTGCATGATCTCC). The 50 ml microtome, mounted onto Superfrost/Plus final PCR reaction contained 1 ml gDNA, 1 ml Microscope Slides (Fisher) and allowed to dry at of each primer, 1 ml dNTP mix (10 mM each of room temperature for 1 hour. Sections were dATP, dTTP, dCTP, dGTP; New England washed with 1X PBST for 15 minutes and Biolabs (NEB)), 5 ml 10X Thermopol II blocked with 2% goat serum (1X PBST, 2 ml Reaction Buffer (NEB), 5 ml dimethyl goat serum, Invitrogen) for 1 hour at room sulfoxide, 0.5 ml Taq Polymerase (NEB) and temperature. Primary antibodies (1:200 Anti- 35.5 ml dH20. PCR reactions were run on an GFP, Synaptic Systems and 1:200 Anti- Eppendorf thermocycler, using the following Calbindin, Swant or 1:200 Anti-GFP, Millipore and 1:200 Anti-GABAB1 R, Novus Biologicals) The rodent's mouth was secured by using the were incubated on the sections overnight at 4oC, incisor adapter on the anterior mount of the followed by three washes in 1X PBST for 15 apparatus. The nose was placed into the nose minutes per wash. Anti-species specific clamp and the head was checked for a level secondary antibodies (anti-mouse Alexa 546 and position (in regards to the apparatus). Fur from anti-rabbit Alexa 488 or anti-rabbit Alexa 546 the top of the top of the head was removed and and anti-mouse Alexa 488, Invitrogen) were cleaned with 70% ethanol and 10% povidone- incubated on the sections for 2 hours at room iodine. A midline incision was made and all temperature, followed by three rinses in 1X soft tissue from the skull surface was removed. PBST for 15 minutes per wash. Images were One 1 mm wide hole was drilled through the skull with a battery-operated drill at Bregma microscopy and processed with Volocity points -5.88mm to -6.24mm and two additional 1.5 mm, anterior-lateral holes were drilled for Nissl Staining- Sagital sections (30 µm)
mounting screws. The dura was manually of transcardially perfused brains were mounted removed. The modified, flanged cannula guide onto Superfrost/Plus Microsoft slides and (Plastics One) and skull screws (Plastics One) allowed to air dry for 24 hours. In order to stain were cleaned in ethanol and saline and vertically and remove the lipids and residual fixation lowered into their correct coordinates. The solutions from the tissue, slices were placed into flanged cannula guide was kept in place by two a 1:1 chloroform/ethanol solution for 45 2.4 mm long, 1.57 mm wide mounting screws. minutes, 5% cresyl violet acetate for 3 minutes A cap of dental cement (3M, Rely-X luting) was applied on top of the head and surrounded the (approximately 4 drops) for 3 minutes with each cannula guide. The wound was permanently step followed with a distilled water wash. closed by applying a thin layer of Vetbond tissue Following the initial stain, slices were adhesive (3M) to each side of the scalp. Animals dehydrated by placing them into a 70% ethanol were subcutaneously administered 1 ml of sterile solution for 3 minutes, 96% ethanol for 3 saline and recovered on a heating pad in minutes, two isopropanol washes for 3 minutes individual cages. In regards to the in vivo each. Two, 5 minute changes of xylene made electrophysiology, data were obtained by any unstained parts of the tissue transparent. performing the above surgical procedure on Finally, coverslips were mounted onto the slides three to six-month old vRh-GFPPC, vRh- with DePeX mounting medium and allowed to GFP(TgflvRh-GFP) and C57/B6 mice. Surgeries dry overnight. Images were taken on an Zeiss were identical except that only one hole was Axiophot equipped with a CCD camera drilled at Bregma points -5.88mm to -6.24mm. (SensiCam, PCO, Kelheim, Germany). Upon completion of the recording session, mice Stereotaxic Surgeries and Cannula
were euthanized by cervical displacement. Placement-Three to six-month old male vRh-
Fiber Optics and Photostimulation- For
GFPPC and wild type littermates were the blue-light photostimulation through the modified subjects of these experiments. All surgeries cannula guide, a diode pumped crystal laser (20 were performed under aseptic conditions. mW, 473 nm, CrystaLaser, Reno, NV, BCL- Rodents were anaesthetized using isoflurane for 473-020) was coupled into a multimode hard one hour or less. Sedation was verified by polymer-clad fiber (200 µm core diameter, 0.37 using the gentle toe pinch withdraw reflex. A numerical aperture, Thorlabs BFL37-200). The lubricating ophthalmic ointment was applied to animal behavior photostimulation protocol prevent corneal drying during surgery. Mice involved applying a 26 second light pulse to the were mounted into the stereotactic frame cerebellar region located directly under the (Narishige Group, Model SR-6M) by placing cannula opening. Protocols for the in vivo non-rupture ear bars into the ear canals and recordings included a 26 second light pulse gently tightened into place. Confirmation of applied 10-20 seconds into each sweep (total correct ear bar placement was dependent upon sweep time approximately 1 minute). complete lateral immobilization of the head. Optrode Construction- A cleaved
lowered into the vermis and recordings were multimode glass optical fiber (50 mm core taken from cells ranging in depth from 1100 to diameter, 0.37 numerical aperature, Thorlabs 3200 mm below the surface. Activity was AFS50/125Y) was stripped of the outer polymer amplified and filtered (bandpass 0.5 to 9 kHz) with a multi-channel spike sorter (Plexon Inc., microelectrode (Impedance 1-2.5MOhm) was Austin, TX) and stored on a computer disk with attached to the stripped end of the optical fiber a sampling rate of 32 kHz. During off-line with epoxy. The optrode was coupled to a blue analysis, simple spikes and complex spikes were laser (Crystal Laser BCL-473-020). Triggering discriminated using custom made software of the laser was controlled by a custom made implemented in Matlab (MathWorks, Natick, Matlab program and a corresponding D/A card. MA). Single cell spike activity was used to Electrophysiological Analysis- Brain
calculate mean firing rates and inter spike Slice Recordings- Sagittal sections (250 µm
intervals. The coefficient of variation (CV) of thick) were cut from the cerebellum of P21, the simple spike interspike intervals was C57/B6 mice. Mice were anaesthetized with calculated to quantify the variability in spike isoflurane and decapitated. The cerebellum was dissected out, cooled and sliced in an ice-cold Baclofen Application- A Union-40
solution containing 87 mM NaCl, 75 mM iontophoresis pump (Kation Scientific) was used sucrose, 2.5 mM KCl, 0.5 mM CaCl2, 7 mM for the extracellular delivery of 1 mM baclofen MgCl2, 1.25 mM NaH2PO4, 25 mM NaHCO3, (dissolved in 150 mM NaCl, pH = 3.5) or saline and 20 mM glucose bubbled with 95% O2 and through a Carbostar-3 (Kation scientific) carbon 5% CO2 with a vibratome (VT1000S, Leica). electrode, which includes 2 barrels for Slices were kept for at least 1 hour at room microiontophoresis. Baclofen was delivered by temperature in a recording artificial cerebral + 50nA ejection pulses and retaining currents spinal fluid composed of 124 mM NaCl, 3 mM were -20nA. Baclofen or saline was applied KCl, 2.5 mM CaCl2, 1.2 mM MgSO4, 1.23 mM for 26 seconds to the Purkinje cells that had both NaH2PO4, 26 mM NaHCO3, and 10 mM glucose simple and complex spikes. bubbled with 95% O2 and 5% CO2. Slices were Lesion Studies- In order to confirm the
continuously perfused with an external solution position of the recording electrodes electrical containing 10 µM CNQX and 100 µM microlesions were created at different sites picrotoxin. Extracellular recordings from following the completion of the in vivo Purkinje cells were made at (temperature) with recordings. Lesion areas were at least 700 µm 10 mM baclofen being perfused during steady apart. The designated regions received a 10 µA state firing. Patch pipettes (2-4 megaohms) anodic current for 1 minute via the recording were filled with an internal solution comprised electrode by using an A365 stimulus isolator of 140 mM potassium methyl sulfate, 4 mM (World Precision Instruments). Following NaCl, 10 mM HEPES, 0.2 mM EGTA, 4 mM lesions, mice immediately underwent a Mg-ATP, 0.3 mM Na-GTP, and 10 mM Tris- paraformaldehyde perfusion. phosphocreatine, pH 7.3 (KOH). Membrane voltages were recorded with an EPC10/2 Rotarod- Mice were placed on a 3.0 cm x 9.5
amplifier (HEKA). PatchMaster software cm rotating drum of an accelerating rotarod (HEKA) was utilized to control voltage and data (Columbus Instruments, Rotamex-5 Rotarod). acquisition. Data was further analyzed with Igor The rod was elevated 44.5 cm above the floor of Pro 6.0 software (Wavemetrics). the apparatus. While the mice were allowed to In Vivo Recordings- Extracellular
acclimate to the rotarod for 1 minute before recordings were taken from vermal Purkinje cell beginning the experimental protocol, no formal layers of adult vRh-GFPPC and wild type prior training was introduced into the testing littermates that underwent stereotactic surgery. paradigm. Testing conditions included Recordings from actual Purkinje cells were application of either no light or a 26 second light confirmed by the presence of both complex and pulse. Upon receiving photostimulation, mice simple spikes. The custom optrode was were promptly placed onto the rotarod where the duration and speed of the run were recorded. light application and a 26 sec light pulse so that Constant acceleration of 40 rotations/min was each animal was measured twice. applied until the mouse fell from the rod and Balance Beam- In order to assess fine
activated the infrared beam. The running motor coordination and balance abilities, the duration and rotarod speed at time of fall were capability to cross a narrow beam onto an recorded. The runs were consecutively enclosed platform was analyzed for each mouse. measured, three times with a 5 min rest period The horizontally placed, 70 cm long beam was 7 between each run. In the case of no light pulse, mm in diameter and situated 50 cm above the animals were allowed to rest for 1 min in table surface. One end of the beam was mounted between each run. If mice were unable to stay to a small, illuminated supportive area while the on the rotarod, they were assigned a baseline other end was fastened to an enclosed (20 cm2) value of 5 seconds. The latency to fall and box. Mice underwent training on the beam for speed were recorded for each mouse. Data was three days (3 trials a day) before data collection. averaged over 3 trials per mouse. Briefly, the mouse was placed at an illuminated Grip Strength Test- The muscle strength
end of the beam and the time required to traverse of wild type and transgenic mice was assessed the beam to the safety platform was recorded. utilizing the Chatillon DFE Series Digital Force In addition to recording the latency, hind feet Gauge (AMETEK TCI Division - Chatillon slips were also noted. Measurements were Force Measurement Systems, Largo, Fla). The taken both with and without light pulses. Data instrument measures both fore- and hindlimb was averaged over 3 trials per mouse. grip strength in laboratory rodents by employing an electronic digital force gauge that directly calculates the animal's peak force value exerted upon a pull bar. To measure forelimb grip Creation of a new optogenetic mouse
strength, animals were held by the tail base and line vRh-GFP(TgflvRh-GFP) for the controlled
lowered at an angle onto the flat wire mesh of expression of vRh in a cell-type specific
the pull bar so that the forelimbs would be manner. To investigate the cell-type specific
exclusively examined. The mouse was slowly function of Gi/o pathway activation within pulled away from the bar at approximately 2.5 neuronal networks in vivo and to analyze the cm/sec until release whereby the force gauge functional impact of pathway activation on recorded the peak tension. Hindlimb grip mouse behavior, we created transgenic mice to strength was determined by similar means specifically activate the Gi/o coupled, light except that the hindlimbs were solely in contact activated GPCR vRh by Cre recombinases. We with the pull bar. Measurements were first identified positive pCZW-fl-Lac-Z-vRh- averaged over 5 trials per mouse with and GFP transgenic founders by genotypic analysis without light pulses and are recorded as the peak and examination of β-galactosidase expression tension (g) and is calculated from the force (Figure 1A). In this construct, Lac-Z is flanked applied to the bar when grasp is released. by loxP sites and followed by the vRh-GFP. The Pole
expression of Lac-Z and vRh-GFP is under the coordination were examined by calculating the control of the ubiquitous chicken β-actin capacity of the mice to navigate an angled pole. promoter-cytomegalovirus enhancer. The vRh- Mice were held by the tail and lowered, head- GFP is only expressed when Lac-Z is excised by upward onto the top of a vertical rough-surfaced Cre recombinases, while LacZ is present pole (diameter 8 mm; height 55 cm). The time throughout the central nervous system (CNS) required for descent to the base of the apparatus when Cre is not expressed (Figure 1A) (14). was recorded with a maximal duration of 120 By performing β-galactosidase staining of both seconds. If the mouse was unable to descend coronal and sagittal sections, we were able to completely and fell off the pole, a maximal visualize abundant LacZ expression throughout default time of 120 sec was assigned to the the CNS. Staining was especially robust in the animal. Experimental conditions included no cerebellum, hippocampus and caudate putamen (Figure 1A) and was also detected in other tissues outside the CNS such as gut, pancreas In vitro and in vivo application of
and stomach. To demonstrate that vRh-GFP baclofen reduces the spontaneous firing rate of
expression can be induced cell-type specifically, Purkinje neurons. We next investigated if the
we crossed mice that expressed Cre recombinase activation of the Gi/o pathway within PC by an under the PCP2/L7 promoter with pCZW-fl- endogenously expressed Gi/o coupled GPCR LacZ-vRh-GFP mice (Figure 1B) for the such as GABAB-R would induce comparable selective expression of vRh-GFP in cerebellar modulation of PC firing as observed for the light PCs (13). We call this mouse line vRh-GFPPC. activation of vRh. Because we are interested in Immunohistochemical staining with GFP and comparing the effects of GABAB-R mediated calbindin antibodies verified that vRh expression Gi/o activation to vRh, we first compared the was exclusive to PCs in mice that had undergone expression between vRh and GABAB1-R in site-specific recombination (Figure 1B). Upon cerebellar PCs. Immunohistochemical staining closer examination, we detected vRh in the PC of sagittal cerebellar sections revealed that soma in a punctate pattern and in the proximal B1-R expression is present in both granule dendrites. Thus, the vRh-GFP(TgflvRh-GFP) mouse and Purkinje cells and can be detected in cell allows for the for cell-type selective, Cre bodies, dendrites and spines of PCs (Figure 3A) recombinase mediated expression of vRh-GFP. (12,15). Overlay studies revealed colocalization Gi/o pathway activation by vRh in vivo
between GFP and GABAB1-R expression in the reduces the frequency of PC firing.We first
soma and proximal dendrites in PCs (Figure examined if activation of vRh by light would 3A), suggesting the possibility that in these modulate PC firing as would be expected from subcellular PC regions, Gi/o pathway activation GPCRs coupling to the Gi/o pathway. To test by light could potentially activate GABAB-R our hypothesis, an optrode coupled to a laser downstream targets but this idea needs to be delivered a 26 second 473 nm light pulse to further investigated. vermal PCs in vivo. Throughout the experiments In order to investigate how GABABR PCs were selected by their characteristic regular activation influences the firing properties of PCs spiking pattern and by the occurrence of in vivo, we iontophoretically applied the complex and simple spikes. Additionally, we GABABR agonist baclofen in 3 month old mice. confirmed the location of the in vivo recording A 26s lasting iontophoretic application of 1 mM site by an electrolytic lesion at the end of the baclofen led to a reduction in the firing experiments (Figure 2A). The recording frequency by 33.6 ± 12.3% (n=8), which was paradigm consisted of an initial 10 sec recording significantly different from the 5.3 ± 4.1% of simple and complex spikes followed by a 26 (n=10) reduction in firing frequency when saline sec light pulse and a post-light recording of 30 was applied (Figure 3B and 3C). No change in sec. vRh-GFPPC mice exhibited an 30.8 ± 4.5 % the CV was detected before and after application (n=9) reduction in the spontaneous firing rate in of baclofen or saline (Figure 3D; CV before and comparison to a 10.9 ± 6.3 % (n=10) increase in after saline application, 0.49 ± 0.06 and 0.52 ± firing in control mice when the 26 sec light pulse 0.06 (n=10); CV before and after 1 mM baclofen was applied (Figure 2B and 2C). No change in application, 0.62 ± 0.07 and 0.69 ± 0.08 (n=8)). the coefficient of variation (CV) was observed A 22.0 ± 11.9 % (n=8) reduction in firing before and after light stimulation (control before frequency was still observed 30 sec after and after light, 0.46 ± 0.03 and 0.47 ± 0.03 baclofen wash out (Figure 3B). In conclusion, (n=10); vRh-GFPPC before and after light, 0.57 ± GABABR activation by baclofen in the PC layer 0.06 and 0.61 ± 0.07 (n=9), Figure 3D). Post- of anaesthetized mice caused a reduction in the light recordings indicated that reduction of firing firing rate of PCs. persisted for at least 30 sec after light was In order to investigate if the reduction in firing switched off (-28.4 ± 7.6% (n=9), Figure 2D). frequency is caused by intrinsic or extrinsic PC Thus, our data show that light-activation of vRh, selectively expressed in PC, reduce the firing recordings of PC firing in cerebellar slices from frequency of PCs in vivo. 4 week old mice and blocked the inhibitory as well as excitatory inputs into PCs with 10 µM CNQX and 100 µM picrotoxin. We concentrated type 93.25 + 9.63 seconds versus vRh-GFPPC on tonically firing PCs, and excluded PCs mice 72.65 + 13.7 seconds; n=10, ANOVA demonstrating a trimodal spiking activity. **p<0.001). There was no significant difference Application of 10 µM baclofen reduced the AP in the time spent on the rotarod without any light firing by 21.9 ± 4.1% (n=5) (Figure 3F and 3G). application between the two groups of mice Again, no change in the CV was detected before (wild type 109.99 +10.57 seconds versus vRh- and after baclofen application (Figure 3H; CV GFPPC mice 101.61 + 14.05 seconds n=10). before and after baclofen application, 0.09 ± Beam walk testing (Figure 4D) also revealed 0.014 and 0.09 ± 0.013 (n=5)). Thus, GABAB-R that the modulation on motor behavior was activation by baclofen in PC in vivo induced a dependent on light (wild type pre-pulse 13.27 + reduction in firing frequency as observed by 2.14 seconds; post-pulse 10.72 + 1.38 seconds; light activation of vRh, suggesting that vRh and vRh-GFPPC pre-pulse 7.43 + 0.53 seconds; post- GABAB-R activate a similar intracellular pulse 17.36 + 4.37 seconds; n = 10, ANOVA signalling pathway to modulate PC firing. Photostimulation of vRh in Purkinje
As an additional control for each cells alters motor behavior. In order to
behavioral test, grip strength for both hind and investigate the functional consequence of Gi/o- front paws was analyzed before and after light mediated modulation of PC firing, we implanted treatment. These tests were performed to a laser guide positioned on top the cerebellum to demonstrate that any significant differences illuminate the cerebellar cortex (Figure 4A). We between wild type and positive transgenic mice chose the anterior vermis as the specific detected throughout the behavioral tests were illumination area because it is known to be attributable to the photoactivation of vRh and involved in balance, equilibrium and motor are not a result of insufficient strength or muscle execution (16-19). In all motor tests ability. Measurements of front grip strength administered, a significant difference was revealed no significant difference between the detectable between wild type and transgenic two groups both before and after light vRh-GFPPC adult mice after a 26s long light application (Figure 4E; wild type pre-pulse 73.0 stimulus was applied to the vermis. Specifically, + 4.99 g; post-pulse 54.9 + 4.55 g; vRh-GFPPC vRh positive mice either fell off the pole after pre-pulse 73.0 + 3.14 g; post-pulse 51.9 + 1.76 light delivery (scored as 120 sec) or took at least g; n=10 ANOVA n.s.). There were also no twice as long to descend to the bottom of the indications of changes in hind grip strength pole (Figure 4B, wild type pre-pulse 17.51 + before and after light application (Figure 4F; 1.67 seconds; post-pulse 11.63 + 0.87 seconds; wild type pre-pulse 24.5 + 1.9 g; post-pulse 22.0 vRh-GFPPC pre-pulse 18.85 + 2.87 seconds; + 1.26 g; vRh-GFPPC pre-pulse 23.67 + 2.82 g; post-pulse 102.1 + 12.4 seconds; n= 10, post-pulse 21.1 + 2.31 g; n=10 ANOVA n.s.). ANOVA ***p<0.0001). The accelerating Thus our results indicate that Gi/o-mediated rotarod test was administered by delivering a modulation of PC firing is sufficient to alter pulse of light at the beginning of the experiment, motor coordination in behaving mice. followed by a performance evaluation without light application. This behavioral paradigm was DISCUSSION
designed this way to control for the possibility that the duration of time spent on the rotarod vRh-GFP(TgflvRh-GFP) mouse for the cell-type
would increase because of the acquisition of selective control of Gi/o signalling. The pursuit
motor skill learning, regardless of transgenic to gain a more thorough understanding of the expression, and could potentially mask any physiological roles of cell-type specific GPCR effects that light activation of vRh may have on signalling in vivo and in vitro has resulted in the firing and behavioral output (20). Accelerating development of two new approaches that rotarod testing revealed that the vRh-GFPPC circumvent the use of traditional receptor- mice stay on the accelerating rod for a shorter specific agonists and antagonists. The first amount of time after light application in consists of a chemical approach that utilizes comparison to wild type mice (Figure 4C, wild engineered GPCRs such as DREADDs, which are activated by inert chemical compounds optimized method for in vivo expression but also (21,22). The second technique is a physical highlights the magnitude of influence that the scheme that employs light-activated proteins to Gi/o pathway has on motor control and the evoke intracellular signalling pathways, like PTX-sensitive Gi/o-coupled vRh in neurons Numerous examinations of the cerebellum and (3,23,24). The advantage of using light-activated specifically the medial cerebellar region have proteins is the guaranteed precise temporal indicated that this area plays a pivotal role in control, which cannot be achieved with regulating extensor tone, sustaining upright application of chemical compounds. To further stance and dynamic balance control (18,19,25). develop and utilize this tool for cell-type specific It is thought that the cerebellum employs applications, we created mice whose expression anticipatory and feedback mechanisms to of vRh-GFP was dependent upon the use of cell- maintain balance during locomotion and that type specific expression of Cre recombinase. failure in these systems induce an ataxic-like The vRh-GFP(TgflvRh-GFP) mice were crossed with PCP2/L7-Cre recombinase (TgPcp2-cre) mice revealed that the photostimulation of positive for selective expression of vRh-GFP in PCs (13). vermal PCs in vRh-GFPPC mice induced The vRh expression was induced one week after changes in motor output. Specifically, an overall birth following Cre-expression and was lack of balance, coordination and performance restricted to PCs of vRh-GFPPC mice (Figure was quite apparent with positive transgenic mice 1B). In order to visualize vRh-GFP after 1-3 that significantly differed from control months of age, an antibody against GFP had to littermates. These results are consistent with be used, suggesting that the vRh-GPF prior studies that have examined the correlation concentration within PCs is low. Despite the between vermal lesions and gait ataxia, postural potential lower expression levels, light defects and motor coordination difficulties and stimulation of vRh in vivo led to a significant highlight the importance of Gi/o modulation of reduction of AP firing in PCs that was PC firing for motor control. As a side note, an comparable to the effects induced by application early examination of light delivery to positively of GABABR agonist, baclofen. As shown by the expressing vRh PCs indicated that the optimal intense lacZ staining, especially within length of activation was around 20 seconds. hippocampus and basal ganglia (Figure 1A), the Similar behavioral responses could be elicited vRh-GFP(TgflvRh-GFP) mouse line is a promising with longer light pulses but was ultimately tool that could be used in the investigation of found to be unnecessary. Furthermore, brief Gi/o signalling in other neuronal populations. pulses of light were unable to reliably evoke According to our studies in PCs, vRh- changes in the intrinsic firing properties of GFP(TgflvRh-GFP) mice provide a new optogenetic tool for the analysis of in vivo function of Considerations for controlling Gi/o signalling
in vivo by light. While we have provided an
Modulation of simple spikes in the medial
effective means to modulate the activity of a cerebellar regions leads to changes in motor
single neuronal population and network, there behavior. One of the surprising findings of our
are several concerns associated with this study study was that a 20-30% reduction in vermal PC that may be influenced by the overall methods firing was sufficient to cause motor deficits in utilized. These potential issues include the freely behaving mice. This finding was extent and range of light penetration within the especially remarkable because the expression cerebellum and the presence of any plausible level of vRh appeared to be relatively low and variables related to light delivery that may limited throughout cerebellar PCs. While no influence the in vivo behavioral and/or quantitative measurement was taken of electrophysiological testing. Previous studies expression levels, vRh was only visible with investigating the feasibility of controlling antibody application. The seemingly restricted neuronal excitability in a noninvasive and light- vRh concentration in vermal PCs not only dependent manner revealed that vRh promoted exhibits the necessity to create an alternative and the modulation of GIRK and P/Q-type Ca2+ channels via a functional coupling to the specific signalling properties of neurons (24), pertussis toxin-sensitive, Gi/o protein pathway further ingenuity is required to overcome the (3). Because vRh couples to the G protein intrinsic issues presented thus far. An additional transducin, whereby the α subunit belongs to the point of contention surrounds the idea that Gi subfamily, these findings offer supporting GABABRs in dissociated PCs have been evidence that mammalian rhodopsins are suggested to inhibit P/Q-type Ca2+ channels (31), capable of coupling to other Gi/o family members establish a heterodimeric functional coupling in vitro. In order to examine the possibility that with mGluR1 at postsynaptic sites of the PF-PC vRh may also promote the precise spatio- synapse (11,32) and are thought to be involved temporal control of the Gi/o pathway in vivo, we in synaptic plasticity (33,34). Therefore, future established an investigation that focused on the studies should be focused on investigating which function of this pathway in animal behavior and downstream signalling pathway is activated and system coordination such as motor control. whether discrete motor learning tasks can be Activation of the G i/o pathway in a membrane modulated by the photoactivation of vRh. An delimited way is the main inhibitory action of additional concern focuses on the delivery of a GPCRs on neuronal excitability (2). Many maximal but specific and controlled amount of different transmitters, such as glutamate, light to the brain tissue. To achieve this goal, a acetylcholine (Ach), serotonin (5-HT) or GABA stripped, multimode optical fiber (200 µm couple via specific GPCRs to the Gi/o pathway, diameter) was coupled to a blue laser light (20 which are expressed throughout the brain. mW of power at 473 nm) and affixed above the Among them, the GABAB receptor (GABABR) cerebellar vermis. It is understood that the is widely distributed throughout the brain light scattering properties within the brain are including the cerebellum (28) and is located in influenced by species and age, incident the granule cell, PC and molecular layer. Within wavelength, and physiological characteristics of the molecular layer GABABRs are found at the the tissue (35-38). Specifically, the blue laser presynaptic terminals of parallel fibers and at the light utilized (473 nm) for this study has been PC dendrites and spines (15,29,30). Taking all described as having a high propensity for of this into consideration, our in vivo data seem scattering within the brain and is also weakly to suggest that the photoactivation of vRh in absorbed (36-38). The specifics of this optrode vermal PCs acts via the Gi/o mediated signalling have been previously characterized in detail and pathway in general. Up to this point, we have it had been estimated that the fiber tip produces not detected the activation of other G protein a total tissue volume experiencing >1 mW mm-2 pathways using vRh such as Gq or Gs in cellular light intensity to be 0.5 mm3 (36). These fiber or neuronal culture systems. Our attempt to optic specifics correlate with our data in that the most significant decrease in the firing rate of exogenously-expressed vRh still remains to be vermal PCs was elicited in neurons located at further developed. There are several matters to more superficial tissue depths; thereby consider that may influence the feasibility of supporting the notion that increase tissue depth controlling Gi/o signalling and include the corresponds to a lower level of light intensity. following: Firstly, Gi/o-coupled GPCRs have a In summary, we generated a new mouse variety of downstream signalling targets and line that allows for the cell-type specific have a binding preference to each of their activation and modulation of the Gi/o pathway respective targets. Secondly, more than one type through vRh, and demonstrated the feasibility of of Gi/o-coupled GPCR is expressed in a single modifying the firing properties of a single neuron and spreads in a specific distributing neuronal population through the utilization of pattern. Lastly, some Gi/o-coupled receptors can light. Thus for the first time, our experimental form heterodimers with other types of GPCRs. results revealed that the in vivo modulation of Although we recently demonstrated the ability to the Gi/o protein pathway in PCs has a significant target and modify GPCRs by tagging vRh with functional influence on motor control and the C-terminal signalling domain of a specific GPCR and were able to control 5-HT1A/Gi/o REFERENCES
LeBeau, F. E., El Manira, A., and Griller, S. (2005) Trends Neurosci 28, 552-561
Hille, B. (1994) Trends Neurosci 17, 531-536
Li, X., Gutierrez, D. V., Hanson, M. G., Han, J., Mark, M. D., Chiel, H., Hegemann, P.,
Landmesser, L. T., and Herlitze, S. (2005) Proc Natl Acad Sci U S A 102, 17816-17821
Thach, W. T., Goodkin, H. P., and Keating, J. G. (1992) Annu Rev Neurosci 15, 403-442
Llinas, R., and Sasaki, K. (1989) Eur J Neurosci 1, 587-602
Hausser, M., Raman, I. M., Otis, T., Smith, S. L., Nelson, A., du Lac, S., Loewenstein, Y.,
Mahon, S., Pennartz, C., Cohen, I., and Yarom, Y. (2004) J Neurosci 24, 9215-9219
Walter, J. T., Alvina, K., Womack, M. D., Chevez, C., and Khodakhah, K. (2006) Nat Neurosci
9, 389-397
Womack, M. D., and Khodakhah, K. (2004) J Neurosci 24, 3511-3521
Billard, J. M., Vigot, R., and Batini, C. (1993) Neurosci Res 16, 65-69
Curtis, D. R., Game, C. J., Johnston, G. A., and McCulloch, R. M. (1974) Brain Res 70, 493-499
Tabata, T., Haruki, S., Nakayama, H., and Kano, M. (2005) J Physiol 563, 443-457
Vigot, R., and Batini, C. (1997) Neurosci Res 29, 151-160
Barski, J. J., Dethleffsen, K., and Meyer, M. (2000) Genesis 28, 93-98
Braz, J. M., Rico, B., and Basbaum, A. I. (2002) Proc Natl Acad Sci U S A 99, 15148-15153
Ige, A. O., Bolam, J. P., Billinton, A., White, J. H., Marshall, F. H., and Emson, P. C. (2000)
Brain Res Mol Brain Res 83, 72-80
Apps, R., and Hawkes, R. (2009) Nat Rev Neurosci 10, 670-681
Ivry, R. B., Keele, S. W., and Diener, H. C. (1988) Exp Brain Res 73, 167-180
Joyal, C. C., Meyer, C., Jacquart, G., Mahler, P., Caston, J., and Lalonde, R. (1996) Brain Res
739, 1-11
Morton, S. M., and Bastian, A. J. (2007) Cerebellum 6, 79-86
Shiotsuki, H., Yoshimi, K., Shimo, Y., Funayama, M., Takamatsu, Y., Ikeda, K., Takahashi, R.,
Kitazawa, S., and Hattori, N. J Neurosci Methods 189, 180-185
Armbruster, B. N., Li, X., Pausch, M. H., Herlitze, S., and Roth, B. L. (2007) Proc Natl Acad Sci
U S A 104, 5163-5168
Pei, Y., Rogan, S. C., Yan, F., and Roth, B. L. (2008) Physiology (Bethesda) 23, 313-321
Masseck, O. A., Rubelowski, J. M., Spoida, K., and Herlitze, S. (2010) Exp Physiol 96, 51-56
Oh, E., Maejima, T., Liu, C., Deneris, E., and Herlitze, S. (2010) J Biol Chem 285, 30825-30836
Lalonde, R., and Strazielle, C. (2007) Prog Neurobiol 81, 45-60
Horak, F. B., and Diener, H. C. (1994) J Neurophysiol 72, 479-493
Timmann, D., and Horak, F. B. (1998) Exp Brain Res 119, 73-84
Bettler, B., Kaupmann, K., Mosbacher, J., and Gassmann, M. (2004) Physiol Rev 84, 835-867
Kulik, A., Nakadate, K., Nyiri, G., Notomi, T., Malitschek, B., Bettler, B., and Shigemoto, R.
(2002) Eur J Neurosci 15, 291-307
Fritschy, J. M., Meskenaite, V., Weinmann, O., Honer, M., Benke, D., and Mohler, H. (1999) Eur
J Neurosci 11, 761-768
Mintz, I. M., and Bean, B. P. (1993) Neuron 10, 889-898
Hirono, M., Yoshioka, T., and Konishi, S. (2001) Nat Neurosci 4, 1207-1216
Kamikubo, Y., Tabata, T., Kakizawa, S., Kawakami, D., Watanabe, M., Ogura, A., Iino, M., and
Kano, M. (2007) J Physiol 585, 549-563
Kawaguchi, S., and Hirano, T. (2000) Neuron 27, 339-347
Zhang, J., Laiwalla, F., Kim, J. A., Urabe, H., Van Wagenen, R., Song, Y. K., Connors, B. W.,
Zhang, F., Deisseroth, K., and Nurmikko, A. V. (2009) J Neural Eng 6, 055007
Aravanis, A. M., Wang, L. P., Zhang, F., Meltzer, L. A., Mogri, M. Z., Schneider, M. B., and
Deisseroth, K. (2007) J Neural Eng 4, S143-156
Bevilacqua, F., Piguet, D., Marquet, P., Gross, J. D., Tromberg, B. J., and Depeursinge, C. (1999)
Appl Opt 38, 4939-4950
Yaroslavsky, A. N., Schulze, P. C., Yaroslavsky, I. V., Schober, R., Ulrich, F., and
Schwarzmaier, H. J. (2002) Phys Med Biol 47, 2059-2073
FOOTNOTES
We would like to thank Dr E.S. Deneris for reading the manuscript, Dr. Ron Conlon and the Case Transgenic and Targeting Facility for creating the mice and Dr. Gemma Casadesus and the CWRU Rodent Behavior Core for assistance in the behavior studies. Also we would like to thank Stephanie Krämer, Margareta Möllmann, Manuela Schmidt, Winfried Junke, Hermann Korbmacher and Volker Rostek for excellent technical assistance. Supported by DFG HE2471/8-1, NIH MH081127 (SH), JSPS Postdoctoral Fellowships for Research Abroad (TM), R36MH086283 (DG). The abbreviations used are: 5-HT, 5-Hydroxytryptamin (Serotonin); ANOVA, analysis of variance; CV, coefficient of variation; DREADD, designer receptors exclusively activated by a designer drug; GFP, green fluorescent protein; GIRK, G protein inwardly rectifying potassium channel; GPCR, G protein coupled receptor; PC, Purkinje cell; PTX, pertussis toxin; S.E.M., standard error of the mean; TEA, triethanolamine; vRh, vertebrate rhodopsin. FIGURE LEGENDS

Fig. 1: Cell-type specific Cre recombinase-mediated expression of vertebrate rhodopsin in
cerebellar Purkinje cells. (A) Schematic description of the construct used to create the transgenic
animals expressing floxed vRh. vRh was cloned into the pCZW vector, which contains a CMV enhancer
and β-actin promoter and a lacZ expression cassette, flanked by two loxP sequences. X-gal staining of
sagittal brain slices from the vRh-GFP(TgflvRh-GFP) mouse line shows β-galactosidase expression
throughout the brain with robust expression localized in the cerebellum (left) and the hippocampus
(middle) and caudate putamen (right). (B) Diagram revealing the results of Cre-mediated recombination
events indicates an excision of the lacZ expression cassette and cell type specific expression of vRh-GFP
driven in PCs. Cre recombinase-mediated induction of vRh-GFP expression in PCs was accomplished
by crossing vRh-GFP(TgflvRh-GFP) mice with Purkinje cell specific CRE (TgPcp2-cre) mice. PC specific
expression of vRh was verified by immunohistochemical staining for GFP (middle) and calbindin (a calcium binding protein associated with Purkinje cells, left). (Right) Three-dimensional reconstruction of confocal z-stack images revealing colocalization of vRh-GFP and calbindin in the soma and proximal dendrites of PCs. Scale bars (left and middle) 25 µm, (right) 10 µm. Fig. 2: In vivo photostimulation of the cerebellar vermis of vRh-GFPPC induces a reduction in the
firing rate of Purkinje cells. (A) NISSL stain of sagittal cerebellum slices after electrolytic lesions
indicate that the in vivo recordings and the application of baclofen (see Figure 3) were directed to the
Purkinje cell layer. (B) PC firing rate recorded and calculated as percent change in firing before and after
light application. The vRh-GFPPC transgenic line demonstrated a significant reduction in firing during the
light pulse that persisted after 30 second once light was switched off. (C) Representative firing rates
(Hz) of individual PCs from control and vRh-GFPPC mice with and without illumination reveal that only
neurons from the vRh-GFPPC line reveal decrease in the firing rate after light treatment. (D) Analysis of
the coefficient of variation (CV) after light application indicates no significant difference between wild
type littermates and vRh-GFPPC mice. (E) Raw traces of control littermates and vRh-GFPPC mice before
and during the 473 nm light pulse reveals a reduction in the PC firing rate only in vRh-GFP positive
transgenic mice. The presence of both simple and complex spikes as well as a comparative analysis of
depth with a standard mouse brain atlas confirmed that recordings were taken from Purkinje cells.
Statistical significance was evaluated with ANOVA. (** P < 0.01). Given values are mean ± S.E.M.

Fig. 3: In vivo and in vitro application of baclofen decreases the firing rate of cerebellar Purkinje
cells. (A-E) In vivo recordings of cerebellar PCs before and after baclofen application. (A) Comparative
immunohistochemical staining of GABAB1R (red) and vRh-GFPPC (green) reveals the expression of
GABAB1R in both PCs and cerebellar cortical neurons. vRh-GFPPC expression is restricted to PCs and
colocalized partly (yellow) with GABAB1Rs. Scale bar 25 µm. (B) Percentage change in number of
spikes for a 10 sec time interval during (t = 16-26 sec) and after (t = 20-30 sec) 1 mM baclofen
application compared to control (saline application). Bar graphs indicate a significant decrease in the
firing of Purkinje cells with baclofen application. (C) Spike frequency (Hz) before and after saline or
baclofen application for each recorded PC demonstrates an overall reduction in firing that corresponds to
baclofen administration. (D) Calculated values for the coefficient of variation (CV) between PCs treated
with saline or baclofen reveals no significant difference in data dispersion between the two treatment
groups. (E) Raw traces of PCs before and during either saline or baclofen treatment indicates reduced
firing in the present of 1 mM baclofen. The presence of both simple and complex spikes as well as a
comparative analysis of depth with a standard mouse brain atlas confirmed that recordings were taken
from Purkinje cells. (F-I) Cerebellar slice recordings of PCs before and after baclofen application. (F)
Percentage change in spike number during the 10 mM baclofen bath application displays reduced firing.
(G) Modifications in the overall firing rate (Hz) for the recorded PCs during baclofen application. (H)
Calculated CV values for extracellular PC recordings indicate no significant difference before and during
baclofen treatment. (I) Raw data traces demonstrating a decrease in PC firing with baclofen. Statistical
significance was evaluated with ANOVA. (* P < 0.05). All values are mean ± S.E.M.

Fig. 4: Light activation of vertebrate rhodopsin expressed in Purkinje cells of the cerebellum
induces changes in motor behavior. (A) Photograph demonstrating the permanent placement of the
cannula light guide used for behavioral testing. (B) Pole test performance of control and vRh-GFPPC
mice (n=10), before and after a 26 sec light pulse. The light activation of vRh in vRh-GFPPC mice results
in either a fall (scored as 120 sec) or an increase in the time required to descend from the pole. Light
application to control littermates did not initiate any significant difference in the time required to descend
the pole. (C) Rotarod performance of wild type littermates (n=10) and vRh-GFPPC mice, before and after
a 26 sec light pulse. Light activation of vRh in vRh-GFPPC mice produces a significant decrease in rotarod
performance when compared to wild type littermates. Performance between the two groups when no
light pulse is applied reveals no significant difference. (D) Beam walk analysis demonstrates an increase
in the time required to successfully cross the length of the beam after vRh activation in vRh-GFPPC mice.
Conversely, the time needed to cross the beam decreases in control littermates, regardless of the light
pulse. Falls were assigned a value of 120 sec. Additionally, a measurement of the number of paw slips
reveals a significant increase after light application for the left side of the vRh-GFPPC mice; whereas
control littermates experienced no significant increase in slips post-light application. (E) Grip strength
assessment of wild type and vRh-GFPPC mice, before and after a 26 sec light illumination. No significant differences were observed for the grip strength of the front and hind paws between wild type littermates and vRh-GFPPC mice before and after light application. Statistical significance in all behavior experiments was evaluated with ANOVA. (* P < 0.05; ** P < 0.01). Shown values are mean ± S.E.M.

Source: http://ko.cwru.edu/publications/Gutierrez.pdf