Chester Clinic

 

Microsoft word - v41n3a25.doc

Brazilian Journal of Microbiology (2010) 41: 729-740 EXPRESSION OF FLJB:Z66 ON A LINEAR PLASMID OF SALMONELLA ENTERICA SEROVAR TYPHI IS
DEPENDENT ON FLIA AND FLHDC AND REGULATED BY OMPR
Shungao Xu, Xin Zou, Xiumei Sheng, Haifang Zhang, Lingxiang Mao, Hong Du, Huaxi Xu, Xinxiang Huang*
Department of Biochemistry and Molecular Biology, Jiangsu University School of Medical Technology, Jiangsu Zhenjiang, Submitted: August 23, 2009; Returned to authors for corrections: October 09, 2009; Approved: March 16, 2010. ABSTRACT

Salmonella enterica serovar Typhi z66-positive strains have two different flagellin genes, fliC:d/j and
fljB:z66, located on the chromosome and on a linear plasmid, respectively. To investigate the mechanism
underlying the expressional regulation of fljB:z66, gene deletion mutants of the regulators FliA, FlhDC,
and OmpR were constructed in this study. The expression levels of fliC and fljB:z66 were analyzed by
qRT–PCR in the wild-type strain and mutants at high and low osmolarity. The results show that the
expression levels of both fljB:z66 and fliC were greatly reduced in fliA and flhDC mutants under both
high and low osmotic conditions. In the ompR mutant, the expression levels of fljB:z66, fliC, fliA, and
flhD were increased at low osmotic conditions. SDS-PAGE and western blotting analysis of the secreted
proteins revealed that the FljB:z66 was almost absent in the fliA and flhDC mutants at both high and low
osmolarity. In the wild-type strain, the fljB:z66 was more highly expressed under high-osmolarity
conditions than under low-osmolarity conditions. However, this difference in expression disappeared in
the ompR mutant. Translational expression assay of FljB:z66 showed that the FljB:z66 expression was
decreased in ompR mutant at both low and high osmolarity. These results suggest that the expression of
fljB:z66 in S. enterica serovar Typhi is dependent on FliA and FlihDC, and OmpR can regulate the
expression and secretion of FljB:z66 in different osmolarity.
Key words: Salmonella enterica serovar Typhi; fljB:z66; flhDC; fliA; ompR.
of the flagellum (17). However, the filament is constructed of only one kind of flagellin protein, which is synthesized in the Flagella are the structural and functional basis of the cell and secreted from it through the central channel of the motility of Salmonella enterica. They are composed of three basic body and the hook of the flagellum and polymerizes substructures: the basal body, the hook, and the filament. The automatically at the top of the filament. The filament of a basal body is the rotor of the flagella motor, embedded in the peritrichous flagellum is composed of approximately 20,000 inner membrane; the hook is a flexible joint between the basal subunits of flagellin protein (1). All flagellar genes can be body and filament; and the filament, which is approximately 5– categorized into three classes based on their transcriptional 10 µm long, acts as the propeller of the microbe (23). About 50 regulation. Class 1 genes, including the master regulatory gene
genes are associated with the structure, assembly, and function flhDC, are necessary to activate the transcription of class 2

*Corresponding Author. Mailing address: Department of Biochemistry and Molecular Biology, Jiangsu University School of Medical Technology, 301 Xuefu
Road, Jiangsu Zhenjiang, 212013, China.; Tel: 86-(0)511-85038449 Fax: 86-(0)511-85012544.; E-mail: [email protected] Xu, S. et al. Expression of fljB:z66 of S. enterica genes. Some class 2 genes encode the proteins of the hook and We examined the expression of fljB:z66 and fliC:j at the basal body. A class 2 gene, fliA, encodes the flagellum-specific mRNA level and the secreted proteins in the wild-type z66+ sigma factor FliA, which transcribes the class 3 genes involved strain and mutants at different osmolarities. We found that the in the motor and chemotaxis functions and filament structures expression of fljB:z66 is dependent on FliA and FlhDC, and (13, 18). that OmpR regulates the expression of fljB:z66 and affects the More than 90 kinds of flagellin have been identified in expression and secretion of FljB:z66 in different osmotic Salmonella by screening with the corresponding antisera (6). environments. Flagellin genes are about 1500 bp in length, with two conservative terminal regions and a highly variable central MATERIALS AND METHODS
region. The corresponding domain of flagellin is located on the
surface of the filament and constitutes the flagellar epitope Bacterial strain and cultures
(20). Most S. enterica serovars are biphasic strains, which
A z66-antigen-positive wild-type strain of S. enterica contain two different flagellin genes, designated fliC (phase I) serovar Typhi GIFU10007 was used in this study. The bacteria and fljB (phase II), located at different loci on the chromosome were grown with shaking at 37 °C in Luria–Bertani (LB) broth (11). After treatment with anti-flagellin antiserum, the biphasic (pH 7.0) containing 50 mM and 300 mM NaCl, representing serovars can express FljB and FliC alternately, which is low- and high-osmolarity environments, respectively. The referred to as "phase variation". Salmonella enterica serovar bacteria were grown overnight at different osmolarities, and then Typhi is an enteric pathogen that causes systemic infections in grown in fresh LB to log phase (OD600 of 0.5) at the same humans, and is traditionally considered a monophasic strain, osmolarity to extract their RNA and secreted proteins. In this only containing fliC, which encodes the d antigen or j antigen study, Escherichia coli SY372λpir was used to harbor the (18, 27). suicide plasmid pGMB151 for the construction of the targeted In 1981, Guinee et al. first identified the H:z66 antigen in gene mutants. the S. enterica serovar Typhi strain, which was isolated from a
patient who had traveled to Indonesia (8). Subsequent Construction of flhDC, fliA, and ompR deletion mutants
investigations show that z66-antigen-positive strains were only
Mutants of flhDC, fliA, and ompR were generated by distributed in Indonesia and Southeast Asia. After it is induced homologous recombination mediated by the suicide plasmid with anti-z66 antiserum, the z66+ strain can alter the expression pGMB151. The primers used to prepare the recombinant DNAs of the flagellar antigen to the d/j form, but the d/j+ strain never and to investigate gene expression are listed in Table 1. To expresses the z66 antigen after induction with anti-d/j generate the ompR mutant, a 1.8-kb fragment including 720 bp antiserum (24). We previously identified the flagellin gene of an ompR-homologous fragment was amplified with PA/B encoding the z66 antigen in z66+ strains as a fljB-like gene from the wild-type strain and cloned into E. coli DH5α with the (fljB:z66) (10). Recent research demonstrated that the fljB:z66 pGEM-T Easy vector, pGEM-T. A 297-bp fragment of the gene and fljA-like gene are located on a novel linear plasmid in ompR gene (nucleotides 100–396) was deleted by treatment with the Typhi z66+ strains (4). The promoter sequence of fljB:z66 is restriction endonucleases NspV and BssHII and an exonuclease different from those of fliCs and fljBs of other biphasic strains (TaKaRa, Japan). The fragment was then transferred into the (10). The regulation of fljB:z66 expression is as yet unclear. suicide plasmid pGMB151 and transformed into E. coli To investigate the regulation of fljB:z66 expression in this SY372λpir. The suicide plasmid carrying the deleted ompR gene study, we first generated deletion mutants of the flagellar was transferred into the wild-type strain by electroporation, as regulator genes (fliA and flhDC) and an ompR deletion mutant. described previously (14). All plasmids were extracted with the Xu, S. et al. Expression of fljB:z66 of S. enterica QIAprep Spin Miniprep Kit (Qiagen) in this study. After were amplified and ligated to form recombinant DNA fragments
selective incubation on LB plates with ampicillin and lacking 471 bp of fliA and 689 bp of flhDC, as described in
streptomycin, the bacteria were selectively incubated on LB Figure 1. These DNA fragments were then separately cloned into
plates with 5% sucrose. The completely recombined strain was the BamHI site of the pGMB151 suicide plasmid. The positive
selected by PCR, confirmed by sequencing analysis and defined suicide plasmids were then transformed separately into the target
as the ompR deletion mutant. To generate the flhDC and fliA strain by electroporation. The selection and identification of the
mutants, gene-specific upstream and downstream fragments mutants were performed as previously described (9).
Table 1. Primers used in this study.
P-ompR-A(Bam HI) ompR mutant construction P-ompR-B(Bam HI) P-flhDC-1A(Bam HI) TAGGATCCATTATGTGATCTGCATCGCA P-flhDC-1B(Bgl II) flhDC mutant construction P-flhDC-2A(Bgl II) P-flhDC-2B(Bam HI) TGGATCCGCCAGTAAAATACCGAGGAA P-fliA-1A(Bam HI) P-fliA-1B(Bgl II) flliA mutant construction P-fliA-2A(Bgl II) P-fliA-2B(Bam HI) pGMBfljB::lacZ construction P-flhD-sA GAGATGGCAAACACACTGGG P-flhD-sB CCGTATCGTCCACTTCATTG P-fliA-sA ACCAACAACAGCCAACTTTT P-fliA-Sb ATTCAATCGCATCCATTACC CAACCGCTAGTGATTTAGTTT CTGTCCCTGTAGTAGCCGTAC GAAACTGCTGTAACCGTTGA CAACGCCAGTACCATCTGTA P-lacZ-sA CGTTACCCAACTTAATC P-lacZ-sB TGTGAGCGAGTAACAAC P-gyrB-sA GAACAGCAGATGAACGAACT P-gyrB-sB TTTTACCTTTCAGCGGCAGA Xu, S. et al. Expression of fljB:z66 of S. enterica Figure 1. Primer design for construction of gene-
deleted mutants and the recombinant plasmid
pGMB151(fljB::lacZ).
Specific primer pairs (P1A/B, P2A/B) located up- and
down-stream of flhDC and fliA were designed to
amplify homologic fragments that were then linked as
the gene defective recombinant fragments. Primer
pair P1A/B specific to the sequence up- and
downstream of ompR were designed to amplify the
homologic fragment, which was digested by NspV
and BssHII and linked as the ompR defective
recombinant fragment.
Primer pairs (P1A/B, P2A/B) specific to the sequence
up- and downstream of fljB were designed to amplify
two homologic fragments that were directionally
linked with the promoterless lacZ cassette as the
recombinant fragment. Recombinant fragments were
individually cloned into the suicide plasmids for
construction of gene-deleted mutants and the
recombinant plasmid pGMB151(fljB::lacZ).
RNA extraction and real-time quantitative reverse
Four pairs of primers specific for fljB:z66, fliC:j, flhD, or transcription–polymerase chain reaction (qRT–PCR)
fliA were designed for qRT–PCR, and are shown in Table 1. The bacterial cells were cooled on ice for 10 min and Reverse transcription was primed with random octamer N8 and harvested by centrifugation (4000 g for 10 min at 4°C). To the SuperScript II kit (Invitrogen), was used according to the destroy the cell envelope, the bacterial cells were resuspended manufacturer's instructions. Each 20 µL reaction contained 2 in 100 µL of lysozyme–TE buffer (0.6 mg/mL lysozyme, pH µg of total RNA and 10 nmol of the random octamer. Each 1 8.0), transferred into an NA extraction mini tube (AMR, Gifu, µL of the reverse transcription product was subjected to a Japan), and vigorously shaken for 3 min at room temperature. quantitative PCR assay, which was performed with primers Total RNA was then extracted with an RNeasy Mini Spin Pz66A/B and PdA/B, as in the previous method (26). Column (Qiagen), according to the manufacturer's instructions. Fluorescence was measured at the end of the synthesis step in The quantity and quality of the extracted RNA were checked each cycle. Serially diluted plasmid DNAs encoding fljB:z66 with Spectrophotometer (NanoDrop were used to construct a standard curve at the same time as a Technologies, Wilmington, USA). To remove any traces of reference from which to calculate the mRNA copy numbers in DNA, the extracted total RNA was treated with 1 U of RNase- the samples. qRT–PCR was performed in duplicate for each free DNase I (TaKaRa, Japan) at 37 °C for 10 min and then RNA sample. The expression level of each gene was incubated at 85°C for 15 min to inactivate the DNase. normalized by the expression level of gyrB, which was Xu, S. et al. Expression of fljB:z66 of S. enterica assumed to be a steadily transcribed housekeeping gene in Control Vector (Promega) was digested with KpnI and SalI. Salmonella (2). Data was expressed as the mean of expression The lacZ cassette was purified with the Wizard SV Gel and ratio. After homogeneity of variance test, the Student's t-test PCR Clean-up System (Promega), according to the was used to assess the statistical significance of differences manufacturer's instructions. After digestion with KpnI and between the groups. SalI, fragments F1 and F2 were ligated with the promoterless lacZ cassette by T4 Ligase (TaKaRa, Japan) as the recombinant Sodium dodecyl sulfate–polyacrylamide gel electrophoresis fragment, F1-lacZ-F2, which was then inserted into the BamHI
(SDS–PAGE) of secreted proteins and proteins in whole-
site of plasmid pGMB151 to form a recombinant plasmid cell lysates and western blot analysis
pGMBfljB::lacZ. The wild-type strain and the ompR mutant The wild-type strain and the mutant strains were incubated were transformed with the recombinant plasmid overnight in 10 mL of LB broth containing 300 mM NaCl at 37 pGMBfljB::lacZ by electroporation. Transformed strains were °C. The secreted proteins were extracted as the previous grown in LB broth to an OD600 of 0.6. When required, the method (10) and dissolved in 20 µL of loading buffer. For the media were supplemented with ampicillin (100 µg/mL). The β-whole-cell lysates, mid-log phase (0.6 OD600) cells were galactosidase assays were performed as described previously harvested, resuspended in PBS. Equal volume of 2× loading (29). Each experiment was performed with three independent buffer was added into each protein sample. After denaturizing samples in duplicate and the values were recorded as β-at 100°C for 10 minutes, proteins were separated by SDS-PAG galactosidase units (nanomoles per minute per OD650 unit per electrophoresis on 15% gels, and visualized with Coomassie milliliter). The activity results were normalized to the plasmid Blue staining. The separated proteins were transferred by copy numbers identified by qRT-PCR (lacZ gene). western blotting onto nitrocellulose membrane, which was probed with rabbit anti-z66 antiserum (National Institute of Infectious Disease, Japan) as the primary antibody and anti- rabbit Ig antibody conjugated to horseradish peroxidase (anti- Expression of fljB:z66 and fliC in ompR, flhDC, and fliA
rabbit Ig–Fc, AP Conjugate, Promega), as described mutants
previously(29).
Flagellar gene expression is typically activated by the regulators FlhDC and FliA (16). The z66-positive S. enterica Transformation of wild type and ompR mutant with the serovar Typhi is a special biphasic strain in which fljB:z66 is
recombinant plasmid pGMB151(fljB::lacZ) and β-
located on a linear plasmid, the source of which is unclear (5). galactosidase assay
To investigate whether fljB:z66 is regulated by FlhDC and FliA To acquire a translational fusion of fljB::lacZ, primer pairs like other biphasic S. enterica, flhDC and fliA mutants were P-fljB-1A/B and P-fljB-2A/B were used to amplify fragments first prepared with a homologous recombination method F1 including whole promoter region of fljB:z66 and F2 located mediated by a suicide plasmid. Sequence analysis downstream from the fljB gene (Figure 1). A SmaI site was demonstrated that the flhDC and fliA mutants were constructed added to the 5′ termini of primers P-fljB-1A and P-fljB-2B, and successfully in this study. To show how flagellin expression is a KpnI site and a SalI site were added to the 5′ termini of affected by the osmotic environment, an ompR mutant was also primers P-fljB-1B and P-fljB-2A, respectively (Table 1). The prepared. The expression of fljB:z66 and fliC in the ompR, two fragments were amplified from the wild-type strain and flhDC, and fliA mutants at low and high osmolarity was digested with SalI and KpnI, respectively. To obtain the analyzed by qRT–PCR with specific primers. The results are promoterless lacZ cassette, the plasmid pSV–β-Galactosidase shown in Figure 2. The expression of fljB:z66 was higher at Xu, S. et al. Expression of fljB:z66 of S. enterica high osmolarity than at low osmolarity in the wild-type strain, type and all mutant strains at both high and low osmolarity, and greatly reduced in the flhDC and fliA mutants at both high whereas the patterns of expression were similar to that of and low osmolarity. Compared with the wild-type strain, the fljB:z66. expression of fljB:z66 in the ompR mutant was increased at low These results indicate that the expression of fljB:z66 is osmolarity but not at high osmolarity. In the ompR mutant, dependent on the regulators FlhDC and FliA, like the there was no obvious difference of fljB:z66 expression between expression of fliC, and that the expression of fljB:z66 at low incubating at low and high osmolarity. The expression of fliC osmolarity is associated with the negative action of OmpR. was more than 10-fold lower than that of fljB:z66 in the wild- Figure 2. Expression of flagellin genes fljB:z66 and fliC in ompR, flhDC, and fliA mutants.
qRT-PCR was performed to investigate the expression of fljB:z66 and fliC in wild type strain (Wt), ompR mutant (ompR-), flhDC
mutant (flhDC-) and fliA mutant (fliA-) incubated at high- and low-osmolarity. The expression of fljB:z66 and fliC was normalized
with the expression of gyrB. Values reported represent means of three independent experiments carried out in duplicate. Bars
represent standard deviations. Student's t-test was used to assess the statistical significance of differences between the groups. **
P<0.01 for a comparison with high-osmolarity in the same strain; ## P<0.01 for a comparison with the wild-type strain at the same
osmolarity.
Xu, S. et al. Expression of fljB:z66 of S. enterica
Expression of flhD and fliA in the ompR mutant
conditions, the expression of flhD and fliA in the ompR mutant We previously found that the expression of the flagellar was investigated with qRT–PCR. The results are shown in genes of Salmonella was strictly reduced early in the period of Figure 3. The expression of flhD and fliA at low osmolarity was hyperosmotic stress and then increased after 2 h of stress (9, higher in the ompR mutant than in the wild-type strain, but 26). Under stationary high-osmolarity conditions, the there was no obvious difference under high-osmolarity expression of fljB was higher than under low-osmolarity conditions. These results suggest that the lower expression of conditions, which seemed to be attributable to OmpR(9, 26). fljB:z66 at low osmolarity is associated with the inhibition of To clarify whether the expression of fljB is regulated by OmpR the expression of flhDC and fliA by OmpR. through the regulators FlhDC and FliA in different osmotic Figure 3. Expression of flhD and fliA in the ompR mutant.
Expression of flhD and fliA in the ompR mutant was investigated by qRT-PCR. Strains were incubated at high- and low-
osmolarity. The expression of flhD and fliA was normalized with the expression of gyrB. Values reported represent means of three
independent experiments carried out in duplicate. Bars represent standard deviations. Student's t-test was used to assess the
statistical significance of differences between the groups. ** P<0.01 for a comparison with high-osmolarity in the same strain; ##
P<0.01 for a comparison with the wild-type strain in the same osmolarity.
Xu, S. et al. Expression of fljB:z66 of S. enterica
FljB:z66 in the secreted proteins of the ompR, flhDC, and of both the flhDC and fliA mutants relative to that of the wild-
fliA mutants
type strain. These results are consistent with the observed Abundant flagellin monomers are synthesized in bacterial fljB:z66 expression confirmed by qRT–PCR and discussed cells and secreted from the cells through the central channel of above. The amount of FljB:z66 in the secreted proteins of the basic body and the hook of the flagellum, from which the wild-type strain was greater at high osmolarity than at low flagellum is automatically polymerized (18). Flagellin in the osmolarity, whereas there was no difference in the secreted bacterial secreted proteins may reflect the expression and proteins of the ompR mutant. There was also more FljB:z66 in secretion of bacterial flagellin (10, 28). In this study, the the secreted proteins of the ompR mutant at low osmolarity FljB:z66 in the secreted proteins was investigated by SDS– than in the wild-type strain. It is likely that the expression and PAGE and a western blotting assay. The results are shown in secretion of FljB:z66 is predominantly inhibited by OmpR at Figure 4. FljB:z66 was greatly reduced in the secreted proteins low osmolarity. Figure 4. SDS–PAGE of secreted proteins and western blot probed with anti-z66 antibody.
Wild type strain and mutants were incubated in high (H) and low (L) osmotic conditions. Secreted proteins were extracted from cultures
with trichloroacetic acid, separated by SDS–PAGE. Western blot was performed with anti-z66 antibody to reflect the amount of the
flagellin FljB:z66 in secreted proteins. There was significantly more FljB:z66 in the secreted proteins of the wild-type strain at high
osmolarity than at low osmolarity. In the ompR mutant, the amount of FljB:z66 in the secreted proteins did not differ significantly at high
and low osmolarity. The amounts of FljB:z66 in the secreted proteins of the flhD and fliA mutants were greatly reduced compare with
that in the wild-type strain.
Xu, S. et al. Expression of fljB:z66 of S. enterica Translational expression of fljB:z66 in the ompR mutant
To further investigate the translational expression of Vi polysaccharide synthesis in S. enterica serovar Typhi is fljB:z66, the wild-type strain and the ompR mutant were promoted by OmpR, especially under low-osmolarity transformed with a low-copy-number plasmid that contained a conditions (19). The Vi polysaccharides play a major role in recombinant fragment of fljB inserted with a promoterless lacZ protecting the pathogen against attack by host macrophages gene for a translational fusion. After incubation under low- and and are thought to act as a physical barrier to secretion in high-osmolarity conditions, the bacteria were harvested to Salmonella (3, 19, 28). To investigate whether the elevated analyze the activity of β-galactosidase. The results are shown levels of FljB:z66 in the proteins secreted by the ompR mutant in Figure 5B. The β-galactosidase activity of the ompR mutant are the result of overall increased secretion, the level of was significantly lower than that in the wild-type strain at both FljB:z66 inside the cells of the ompR mutant was investigated. low and high osmolarity. These results suggest that the The proteins in whole-cell lysates of Salmonella were translational expression of FljB:z66 in the ompR mutant is harvested and the amount of FljB:z66 was analyzed by SDS– lower than that in the wild-type strain, which is similar to the PAG electrophoresis and western blotting. The results are previous western blot results for FljB:z66 in whole-cell lysates. shown in Figure 5A. FljB:z66 in the ompR mutant was lower These results revealed that OmpR might regulate translation of than that in the wild-type strain in both high- and low- fljB:z66 in S. enterica serovar Typhi at different osmolarity. osmolarity environments. Figure 5. Translational expression of fljB:z66 in wild-type and ompR mutant strains.
A: Expression of FljB:z66 was investigated by SDS-PAG electrophoresis and western blotting in whole-cell lysates of the wild-type
strain and ompR mutant incubated at high and low osmolarities. The expression of FljB:z66 in the ompR mutant was slightly lower than
that in the wild-type strain at both low and high osmolarities. B: Assay of β-galactosidase activity in the wild-type and ompR mutant transformed with a recombinant plasmid was performed to reflect the translational expression of fljB:z66. The translational expression of fljB:z66 in the ompR mutant was lower than that in the wild-type strain (# P<0.05) at both low and high osmolarities, which is consistent with the results of western blotting. Xu, S. et al. Expression of fljB:z66 of S. enterica DISCUSSION
flhDC expression in S. enterica serovar Typhimurium (16). The relationship between OmpR and the expression of fljB:z66 was The motility of S. enterica serovar Typhi depends on the first investigated in this study. After the preparation of an structure and function of the flagellum. The z66-positive S. ompR mutant, the expression of fljB:z66 was analyzed by qRT–enterica serovar Typhi is a special biphasic strain containing a PCR. The results showed that OmpR inhibited the transcription fljBA-like gene on a linear plasmid, which encodes the flagellin of fljB:z66 at low osmolarity but not at high osmolarity. This z66 antigen and a fliC repressor (4, 29). The expression and also occurs in the expression of the phase-1 flagellin gene regulation of fljB:z66 is interesting because the promoter of fliC:j. Combined with the results of flhD and fliA expression fljB:z66 is different from the promoters of the fljBs of other assay, we consider that nonphosphorylated OmpR may inhibit biphasic S. enterica (10). Whether the fljB:z66 gene is a class 3 the expression of fljB:z66 indirectly by repressing the flagellar gene has not been clarified. expression of flhDC in S. enterica serovar Typhi under low- To investigate the characteristics of the regulation of osmolarity conditions. To investigate whether the inhibition of fljB:z66 gene expression in this study, we constructed mutants flhDC is direct, we performed the gel shift experiment with an flhDC– and fliA– in which the flagellar-regulator genes were expressed OmpR-his6 and a DNA fragment of the upstream deleted. With qRT–PCR, we first found that fljB:z66 gene region of the flhD (-286 to +199 bp). We did not find the expression is dependent on the regulator genes flhDC and fliA. positive result comparing with a positive control with the This was confirmed with a western blotting assay of FljB:z66 upstream region of the ompF (data not shown). So, we in the bacterially secreted proteins. The cascade of flagellin speculate that OmpR may indirectly regulate the transcription expressional regulation in Enterobacteriaceae are well known of flhDC. as that the central regulator FlhD2C2 activates transcription of Flagellin monomers are secreted by the bacterium and are class 2 flagellar genes and fliA, which then promotes easily detected among the secreted proteins. Experiments have expression of FliC and other class 3 flagellin genes. Therefore, suggested that Vi capsular antigen is a barrier to the secretion we believe that the fljB:z66 gene is also a class 3 flagellar gene of flagellin in S. enterica serovar Typhi (3). Other research has in S. enterica serovar Typhi. demonstrated that TviA, an activator of Vi capsular antigen, The flagellum is an important pathogenic factor of S. reduces flagellin secretion (25). Vi capsular antigen is a enterica serovar Typhi (12, 21). During the invasion process, negative factor for S. enterica serovar Typhi invasion into host the pathogen encounters osmotic upshift stress in the small enteric M cells. When entering a high-osmolarity enteric intestinal tract. We previously found that the expression of environment, S. enterica serovar Typhi can increase its fljB:z66 is clearly reduced in the early stage of osmotic stress expression and secretion of flagellin and SPI-1 Sip proteins by and increases under stationary high-osmolarity conditions (9, reducing the expression of Vi capsular genes (3). In this study, 26). OmpR is an osmoresponsive regulator, which forms a two- we also found that large amounts of FljB:z66 appeared in the component regulatory system with EnvZ, an osmosensor secreted proteins at high osmolarity. In ompR mutant amounts located on the inner membrane of the cell (7). The previous of FljB:z66 appeared in the secreted proteins at low osmolarity research found that phosphorylated OmpR was a negative almost same as that at high osmolarity. However, translational regulator for flhD expression in E. coli in the high osmolarity expression investigation of fljB:z66 revealed that OmpR did condition (22). Another research found that inactivation of not repressed the synthesis of FljB:z66 in S. enterica serovar ompR promoted flhDC expression and swarming in Typhi both at high and low osmolarity. Large amount of Xenorhabdus nematophila incubated on LB plate with middle FljB:z66 in secreted protein in ompR mutant at low osmolarity osmolarity (15). However, inactivation of ompR did not affect was predominantly the result of the increase in secretion by S. Xu, S. et al. Expression of fljB:z66 of S. enterica enterica serovar Typhi. It is interesting that the translational (1981). An unusual H antigen (Z66) in strains of Salmonella typhi. Ann. expression of fljB:z66 was not significantly different under Microbiol (Paris). 132(3), 331-334. Huang, X.; Xu, H.; Sun, X.; Ohkusu, K.; Kawamura, Y.; Ezaki, T. high and low osmotic conditions, although its transcriptional (2007). Genome-Wide Scan of the Gene Expression Kinetics of expression differed. It is likely that regulation of FljB:z66 Salmonella enterica Serovar Typhi during Hyperosmotic Stress. secretion is major response to osmolarity and expressional International Journal of Molecular Sciences. 8(2), 116-135. regulation of fljB:z66 by OmpR is happen not only in 10. Huang, X.; Phung le, V.; Dejsirilert, S.; Tishyadhigama, P.; Li, Y.; Liu, H.; Hirose, K.; Kawamura, Y.; Ezaki, T. (2004). Cloning and transcriptional level but also in some posttranscriptional levels characterization of the gene encoding the Z66 antigen of Salmonella in S. enterica serovar Typhi at different osmolarity. enterica serovar Typhi. FEMS. Microbiol. Lett. 234(2), 239-246. 11. Ikeda, J.S.; Schmitt, C.K.; Darnell, S.C.; Watson, P.R.; Bispham, J.; Wallis, T.S.; Weinstein, D.L.; Metcalf, E.S.; Adams, P.; O'Connor, C.D.; O'Brien, A.D. (2001). Flagellar phase variation of Salmonella enterica This work was supported by grants from National Natural serovar Typhimurium contributes to virulence in the murine typhoid infection model but does not influence Salmonella-induced Science Foundation of China (30570088), National Special enteropathogenesis. Infect. Immun. 69(5), 3021-3030. Scientific Program (2008ZX10004-009), and SIT of Jiangsu 12. Jones, B.D.; Lee, C.A.; Falkow, S. (1992). Invasion by Salmonella University (2008-018-02). typhimurium is affected by the direction of flagellar rotation. Infect. Immun. 60(6), 2475-2480. 13. Kerridge, D.; Horne, R.W.; Glauert, A.M. (1962). Structural components REFERENCES
of flagella from Salmonella typhimurium. J Mol. Biol. 4, 227-238. 14. Khan, A.Q.; Zhao, L.; Hirose, K.; Miyake, M.; Li, T.; Hashimoto, Y.; Aizawa, S.I. (1996). Flagellar assembly in Salmonella typhimurium. Mol. Kawamura, Y.; Ezaki, T. (1998). Salmonella typhi rpoS mutant is less Microbiol. 19(1), 1-5. cytotoxic than the parent strain but survives inside resting THP-1 Ansong, C.; Yoon, H.; Porwollik, S.; Mottaz-Brewer, H.; Petritis, B.O.; macrophages. FEMS. Microbiol. Lett. 161(1), 201-208. Jaitly, N.; Adkins, J.N.; McClelland, M.; Heffron, F.; Smith, R.D. (2009). 15. Kim, D.J.; Boylan, B.; George, N.; Forst, S. (2003). Inactivation of ompR Global systems-level analysis of Hfq and SmpB deletion mutants in promotes precocious swarming and flhDC expression in Xenorhabdus Salmonella: implications for virulence and global protein translation. nematophila. J. Bacteriol. 185(17), 5290-5294. PLoS. One. 4(3), e4809. 16. Kutsukake, K. (1997). Autogenous and global control of the flagellar Arricau, N.; Hermant, D.; Waxin, H.; Ecobichon, C.; Duffey, P.S.; master operon, flhD, in Salmonella typhimurium. Mol. Gen. Genet. Popoff, M.Y. (1998). The RcsB-RcsC regulatory system of Salmonella 254(4), 440-448. typhi differentially modulates the expression of invasion proteins, 17. Kutsukake, K.; Ohya, Y.; Iino, T. (1990). Transcriptional analysis of the flagellin and Vi antigen in response to osmolarity. Mol. Microbiol. 29(3), flagellar regulon of Salmonella typhimurium. J. Bacteriol. 172(2), 741- Baker, S.; Holt, K.; Whitehead, S.; Goodhead, I.; Perkins, T.; Stocker, B.; 18. Macnab, R.M. (1996). Flagella and motility. In:Neidhardt, F. C.; Curtiss, Hardy, J.; Dougan, G. (2007). A linear plasmid truncation induces R. I.; Ingraham, J. L.; Lin, E. C. C.; Low, K. B.; Magasanik, B.; unidirectional flagellar phase change in H:z66 positive Salmonella Typhi. Reznikoff, W. S.; Riley, M.; Schaechter, M.; Umbarger, H. E.(eds). Mol. Microbiol. 66(5), 1207-1218. Escherichia coli and Salmonella : cellular and molecular biology. Baker, S.; Hardy, J.; Sanderson, K.E.; Quail, M.; Goodhead, I.; Kingsley, American Society for Microbiology, Washington, D.C., p.123-141. R.A.; Parkhill, J.; Stocker, B.; Dougan, G. (2007). A novel linear plasmid 19. Pickard, D.; Li, J.; Roberts, M.; Maskell, D.; Hone, D.; Levine, M.; mediates flagellar variation in Salmonella Typhi. PLoS. Pathog. 3(5), Dougan, G.; Chatfield, S. (1994). Characterization of defined ompR mutants of Salmonella typhi: ompR is involved in the regulation of Vi Edwards, P.R.; Ewing, W.H. (1986). Edwards and Ewing's Identification polysaccharide expression. Infect. Immun. 62(9), 3984-3993. of Enterobacteriaceae. Elsevier Science Publishing Co., New York. 20. Popoff, M.Y.; Minor, L.L. (1992). Antigenic formulas of the Salmonella Gibson, M.M.; Ellis, E.M.; Graeme-Cook, K.A.; Higgins, C.F. (1987). serovars, 6th revision. WHO Collaborating Center for Reference and OmpR and EnvZ are pleiotropic regulatory proteins: positive regulation Research on Salmonella. Institute Pasteur, Paris, France, of the tripeptide permease (tppB) of Salmonella typhimurium. Mol. Gen. 21. Schmitt, C.K.; Ikeda, J.S.; Darnell, S.C.; Watson, P.R.; Bispham, J.; Genet. 207(1), 120-129. Wallis, T.S.; Weinstein, D.L.; Metcalf, E.S.; O'Brien, A.D. (2001). Guinee, P.A.; Jansen, W.H.; Maas, H.M.; Le Minor, L.; Beaud, R. Absence of all components of the flagellar export and synthesis Xu, S. et al. Expression of fljB:z66 of S. enterica machinery differentially alters virulence of Salmonella enterica serovar flagellin secretion. Cell. Microbiol. 10(1), 247-261. Typhimurium in models of typhoid fever, survival in macrophages, tissue 26. Xu, S.; Zhang, H.; Sheng, X.; Xu, H.; Huang, X. (2008). Transcriptional culture invasiveness, and calf enterocolitis. Infect. Immun. 69(9), 5619- expression of fljB:z66, a flagellin gene located on a novel linear plasmid of Salmonella enterica serovar Typhi under environmental stresses. New. 22. Shin, S.; Park, C. (1995). Modulation of flagellar expression in Microbiol. 31(2), 241-247. Escherichia coli by acetyl phosphate and the osmoregulator OmpR. J. 27. Yamaguchi, S.; Fujita, H.; Sugata, K.; Taira, T.; Iino, T. (1984). Genetic Bacteriol. 177(16), 4696-4702. analysis of H2, the structural gene for phase-2 flagellin in Salmonella. J. 23. Sosinsky, G.E.; Francis, N.R.; Stallmeyer, M.J.; DeRosier, D.J. (1992). Gen. Microbiol. 130(2), 255-265. Substructure of the flagellar basal body of Salmonella typhimurium. J. 28. Zhao, L.; Ezak, T.; Li, Z.Y.; Kawamura, Y.; Hirose, K.; Watanabe, H. Mol. Biol. 223(1), 171-184. (2001). Vi-Suppressed wild strain Salmonella typhi cultured in high 24. Tamura, K.; Sakazaki, R.; Kuramochi, S.; Nakamura, A. (1988). osmolarity is hyperinvasive toward epithelial cells and destructive of Occurrence of H-antigen Z66 of R phase in cultures of Salmonella Peyer's patches. Microbiol. Immunol. 45(2), 149-158. serovar typhi originated from Indonesia. Epidemiol. Infect. 101(2), 311- 29. Zou, X.; Huang, X.; Xu, S.; Zhou, L.; Sheng, X.; Zhang, H.; Xu, H.; Ezaki, T. (2009). Identification of a fljA gene on a linear plasmid as the 25. Winter, S.E.; Raffatellu, M.; Wilson, R.P.; Russmann, H.; Baumler, A.J. repressor gene of fliC in Salmonella enterica serovar Typhi. Microbiol. (2008). The Salmonella enterica serotype Typhi regulator TviA reduces Immunol. 53(4), 191-197. interleukin-8 production in intestinal epithelial cells by repressing

Source: http://mlt.ujs.edu.cn/yyswhx/research/papers/2010-2.pdf