Chester Clinic

 

Cris.cumulus.vub.ac.be

Vrije Universiteit Brussel
Regulation of beta2-Adrenergic Receptor Function by Conformationally Selective
Single-Domain Intrabodies
Staus, Dean P.; Wingler, Laura M.; Strachan, Ryan T.; Rasmussen, Soren G. F.; Pardon, Els;
Ahn, Seungkirl; Steyaert, Jan; Kobilka, Brian K; Lefkowitz, Robert J.
Published in:Molecular Pharmacology Document VersionEarly version, also known as pre-print Citation for published version (APA):Staus, D. P., Wingler, L. M., Strachan, R. T., Rasmussen, S. G. F., Pardon, E., Ahn, S., . Lefkowitz, R. J.
(2014). Regulation of beta2-Adrenergic Receptor Function by Conformationally Selective Single-DomainIntrabodies. Molecular Pharmacology, 85, 472-481. 10.1124/mol.113.089516 General rights
Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners
and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights.
• Users may download and print one copy of any publication from the public portal for the purpose of private study or research.
• You may not further distribute the material or use it for any profit-making activity or commercial gain • You may freely distribute the URL identifying the publication in the public portal Take down policy
If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately
and investigate your claim.
Download date: 07. okt. 2016 Supplemental Material can be found at: MOLECULAR PHARMACOLOGY Mol Pharmacol 85:472–481, March 2014 Copyright ª 2014 by The American Society for Pharmacology and Experimental Therapeutics Regulation of b2-Adrenergic Receptor Function byConformationally Selective Single-Domain Intrabodies s Dean P. Staus, Laura M. Wingler, Ryan T. Strachan, Soren G. F. Rasmussen, Els Pardon,Seungkirl Ahn, Jan Steyaert, Brian K. Kobilka, and Robert J. Lefkowitz Department of Medicine (D.P.S., L.M.W., R.T.S., S.A., R.J.L.), Department of Biochemistry (R.J.L.), and Howard Hughes MedicalInstitute (R.J.L.), Duke University Medical Center, Durham, North Carolina; Department of Neuroscience and Pharmacology, ThePanum Institute, University of Copenhagen, Copenhagen, Denmark (S.G.F.R.); Structural Biology Brussels and StructuralBiology Research Institute, Vrije Universiteit Brussel, Brussels, Belgium (E.P., J.S.); and Department of Molecular and CellularPhysiology, Stanford University School of Medicine, Stanford, California (B.K.K.) Received September 9, 2013; accepted December 5, 2013 ABSTRACTThe biologic activity induced by ligand binding to orthosteric or we transiently expressed them intracellularly as "intrabodies" to allosteric sites on a G protein–coupled receptor (GPCR) is test their effects on b2AR-dependent signaling. Conformational mediated by stabilization of specific receptor conformations. In specificity was preserved after intrabody conversion as demon- the case of the b2 adrenergic receptor, these ligands are gen- strated by the ability for the intracellularly expressed nanobodies erally small-molecule agonists or antagonists. However, a mono- to selectively bind agonist- or antagonist-occupied receptors.
meric single-domain antibody (nanobody) from the Camelid When expressed as intrabodies, they inhibited G protein ac- family was recently found to allosterically bind and stabilize an tivation (cyclic AMP accumulation), G protein–coupled receptor active conformation of the b2-adrenergic receptor (b2AR). Here, kinase (GRK)–mediated receptor phosphorylation, b-arrestin we set out to study the functional interaction of 18 related recruitment, and receptor internalization to varying extents. These nanobodies with the b2AR to investigate their roles as novel functional effects were likely due to either steric blockade of tools for studying GPCR biology. Our studies revealed several downstream effector (Gs, b-arrestin, GRK) interactions or sta- sequence-related nanobody families with preferences for active bilization of specific receptor conformations which do not support (agonist-occupied) or inactive (antagonist-occupied) receptors.
effector coupling. Together, these findings strongly implicate Flow cytometry analysis indicates that all nanobodies bind to nanobody-derived intrabodies as novel tools to study GPCR epitopes displayed on the intracellular receptor surface; therefore, three main protein families: heterotrimeric GTP-binding pro-teins (G proteins), G protein–coupled receptor kinases (GRKs), The conversion of extracellular cues into specific intracellular and b-arrestins. The agonist-induced interaction between responses is often mediated by G protein–coupled receptors receptor and G protein promotes exchange of GDP for GTP, (GPCRs) and is critical for regulating nearly all physiological pro- leading to dissociation of the heterotrimeric G protein subunits cesses. For these reasons, GPCRs have become popular therapeutic (Gabg). The free subunits bind to and regulate downstream targets. Even though the GPCR superfamily consists of nearly 800 effectors that commonly generate second messengers such as genes, the general mode of activation and desensitization remains cAMP (Neves et al., 2002). Receptor desensitization is initiated remarkably conserved (Lagerstrom and Schioth, 2008).
by GRK-dependent phosphorylation of residues in the receptor Agonist binding to the orthosteric pocket stabilizes specific carboxyl tail and/or in an intracellular loop, which subse- receptor conformations leading to the sequential binding of quently leads to the recruitment of the multifunctional adaptorprotein b-arrestin (Benovic et al., 1987). Importantly, receptor This work was supported, in part, by the National Institutes of Health phosphorylation and b-arrestin binding require specific active National Heart, Lung, and Blood Institute [Grants HL16037 and HL70631] (toR.J.L.). R.J.L. is an Investigator with the Howard Hughes Medical Institute.
receptor conformations. The coupling of b-arrestin promotes L.M.W. and R.T.S. contributed equally to this work.
desensitization by sterically blocking further G protein binding and facilitating receptor internalization by acting as an This article has supplemental material available at adaptor for the endocytic machinery (reviewed in Shenoy and ABBREVIATIONS: b2AR, b2-adrenergic receptor; BI-167107, 5-{2-[1,1-dimethyl-2-(o-tolyl)ethylamino]-1-hydroxyethyl}-8-hydroxy-4-oxa-1-aza-1,3-dihydronaphthalen-2-on; BSA, bovine serum albumin; CGP-12177A, 4-[3-[(1,1-dimethylethyl)amino]2-hydroxypropoxy]-1,3-dihydro-2H-benzimidazol-2-one hydrochloride; DDM, N-dodecyl b-D-maltopyranoside; DMSO, dimethylsulfoxide; ELISA, enzyme-linked immunosorbentassay; Emax, maximal effect; GPCR, G protein–coupled receptor; G protein, GTP binding protein; GRK, G protein–coupled receptor kinase; HA,hemagglutinin; HEK293, human embryonic kidney 293; HRP, horseradish peroxidase; Ib, intrabody; ICI-118551, 3-(isopropylamino)-1-[(7-methyl-4-indanyl)oxy]butan-2-ol; ISO, isoproterenol; MISC, miscellaneous; MNG, maltose-neopentyl glycol; Nb, nanobody; RT, room temperature; TEV,tobacco etch virus; tTA, tetracycline transactivator protein; b2V2, b2AR with C-terminal tail replaced with that of the vasopressin-2-receptor.
Conformationally Selective Intrabodies Regulate b2AR Function Lefkowitz, 2011). In addition to their role in controlling re- was amplified using the 59-GGGGGATCCAGTATGTACCCATAC- ceptor silencing and trafficking, b-arrestins can also interact GATGTTCCAGATTACGCTCAGGTGCAGCTGCAGGA GTCTG-39 and with a variety of signaling proteins leading to a unique me- chanism of receptor-mediated signal transduction (see Shukla subcloned into pcDNA3.1 with an N terminus hemagglutinin (HA) orMyc tag. The pcDNA3.1 b et al., 2011, for a comprehensive review).
2AR-Gsa fusion plasmid was constructed based on the strategy by Bertin et al. (1994). HEK293 cells stably expressing The biologic activity of most GPCRs is regulated by ligand- 3 pmol/mg b2AR were maintained as previously described (Shenoy et al., mediated stabilization of specific receptor conformations that 2006). M2 antibody–conjugated agarose beads, horseradish peroxidase activate or inhibit downstream signaling events. In the case of (HRP)–conjugated M2 antibody, tubulin antibody, and all b2AR ligands the b2-adrenergic receptor (b2AR), these ligands have been were purchased from Sigma-Aldrich (St. Louis, MO). Antibodies against primarily small molecules that bind to the orthosteric binding total (H20) and p355/6 (sc-22191-R) b2AR were obtained from Santa site. Alternatively, allosteric ligands, which bind sites topo- Cruz Biotechnology (Dallas, TX). HA-tag antibody, peptide-N-glycosidase graphically distinct from the orthosteric binding pocket, could F, and all secondary immunofluorescent reagents were purchased from be useful in further stabilizing specific receptor conformational Cell Signaling Technology (Danvers, MA), New England Biolabs (Ipswich, states. With particular relevance to the b MA), and Invitrogen (Carlsbad, CA), respectively.
2AR, a single-domain Camelid heavy-chain–only antibody (nanobody) was recently Nanobody Generation and Purification. Camelid single-chain antibody fragments (nanobodies) show promise for stabilizing active described that allosterically binds to and stabilizes a specific GPCR conformations and as chaperones for crystallogenesis. b agonist-activated b 2AR conformation, which was essential for specific nanobodies were generated as previously described (Steyaert capturing the active state by crystallography (Rasmussen and Kobilka, 2011). In brief, one llama (Lama glama) received six et al., 2011a).
weekly injections of 100 mg of lipid reconstituted b2AR truncated at More broadly, the use of antibodies as GPCR allosteric residue 365 bound to the high-affinity agonist BI-167107 (5-{2-[1,1- modulators is well founded given their ability to bind a vast array of protein epitopes with high specificity and affinity 1,3-dihydronaphthalen-2-on). The nanobody coding sequences were (reviewed in Gupta et al., 2008). The use of antibodies to fine- amplified from total lymphocyte RNA and subcloned into a phage tune receptor function in a whole-cell context has mainly been display vector. After two rounds of panning, 96 individual colonies restricted to those that bind extracellular epitopes, since were randomly picked, and the nanobodies were produced as a solubleHis-tagged protein in the periplasm of Escherichia coli. The initial antibody delivery into the cytoplasm is a challenging en- solid-phase enzyme-linked immunosorbent assay (ELISA) screen deavor. Intracellular expression of correctly folded antibodies identified 16 nanobodies that recognized native but not heat- is also very difficult due to the reducing cytoplasmic environ- denatured b2AR. All nanobodies (Nbs) were produced in E. coli and ment. Although intracellular expression of antibodies (intra- purified from the periplasmic extract via nickel-agarose. Final bodies) can be achieved by conversion into single-chain fragment nanobody buffer composition consisted of 20 mM HEPES (pH 7.4) variants, antibody function and specificity is often lost (Lo et al., and 100 mM NaCl (buffer A).
Nanobody-b2AR ELISA. Maxisorp (NUNC) 96-well plates (Thermo Heavy-chain antibodies from the Camelid family, which Scientific, Indianapolis, IN) were seeded with 100 ml of 10 mg/ml lack the light-chain polypeptide and first constant domain, purified nanobody overnight at 4°C. Each new reagent addition was have become of interest since they can be converted into preceded by three 5-minute washes with 300 ml of wash buffer[buffer A plus 0.02% DDM (N-dodecyl b- functional single-domain–containing antibodies (nanobodies) D-maltopyranoside)]. The plate was blocked for 60 minutes at room temperature (RT) in wash consisting of a single monomeric variable domain (Vincke and buffer with 3% nonfat milk. Solubilized full-length human b2AR was Muyldermans, 2012). Their small size (∼12 kDa), enhanced purified as previously described (Kahsai et al., 2011) and preincu- stability, high protein yields in bacterial expression systems, bated with dimethylsulfoxide (DMSO), 10 mM BI-167107 or ICI- and high propensity for antigen recognition have made nanobodies very useful tools in protein biology. It has been for 30 minutes in buffer A, 0.1% DDM, and 0.5% bovine serum well documented that nanobodies are capable of binding albumin (BSA). Immobilized nanobodies were incubated with 100 ml cryptic epitopes such as those found in the catalytic site of of 0.5 mg/ml purified b2AR for 90 minutes at RT. Captured b2AR was enzymes or ligand binding pockets of receptors (reviewed in detected using M2-HRP (1:5000) diluted in buffer A, 0.02% DDM, Muyldermans, 2013). Furthermore, specific nanobodies have and 0.5% BSA. Antibody was incubated for 1 hour at RT, plates were been found to exert agonistic or antagonistic effects on their subsequently treated with 100 ml Ultra-TMB (Pierce, Rockford, IL),and absorbance was measured at 450 nm.
antigens either as orthosteric or allosteric modulators, mak- ing them interesting pharmacological tools.
2AR Expression. HEK293 cells were trans- fected with Fugene (Roche, Indianapolis, IN) as described by the In light of the demonstrated ability of nanobodies to bind manufacturer. In brief, subconfluent HEK293 cells were transfected distinct conformational states of the b2AR and their single- with a 3:1 ratio of pcDNA-HA-intrabody and pBK-FLAG-b2AR, re- domain nature, we hypothesized that intracellular expression spectively, and scraped into lysis buffer [20 mM HEPES, 100 mM NaCl, of b2AR-specific nanobodies could yield novel tools for the 0.5% maltose-neopentyl glycol (MNG)] 48 hours post-transfection. For study and regulation of receptor function.
b2AR deglycosylation, 250 units of peptide-N-glycosidase F (NewEngland Biolabs) were incubated with MNG-extracted lysate at roomtemperature for 1 hour. Intrabody and b2AR expression were assessed Materials and Methods by running equivalent total protein on SDS-PAGE and subsequentlyimmunoblotting with HA-HRP (Cell Signaling Technology) or M2-HRP Reagents, Cell Culture, and Plasmids. Human embryonic kidney (Sigma-Aldrich) antibodies, respectively. Equal loading was assessed 293 (HEK293) and U2OS cells were purchased from the American Type using an anti-tubulin antibody (Sigma-Aldrich). To determine functional Culture Collection (Manassas, VA) and grown under the recommended receptor expression, HEK293 cells were transfected as described earlier, conditions. FLAG-human b2AR and rat b-arrestin-2 were subcloned into and 48 hours post-transfection, cells were removed from the culture the mammalian expression plasmids pBK-CMV or pEGFP, respectively, dishes using a 0.5% EDTA solution (Sigma-Aldrich). One well of a 6-well using standard procedures. To generate intrabodies, nanobody cDNA dish was equally divided into four binding reactions and incubated with Staus et al.
30 nM [3H]CGP-12177A (4-[3-[(1,1-dimethylethyl)amino]2-hydroxypro- counter (PerkinElmer, Waltham, MA) following extraction with poxy]-1,3-dihydro-2H-benzimidazol-2-one hydrochloride) plus either as- Lefko Fluor scintillation cocktail (RPI, Mount Prospect, IL).
say buffer (Dulbecco's modified Eagle's medium plus 20 mM HEPES) or [3H]Methoxyfenoterol Binding Assay. We developed the 10 mM propranolol (nonspecific).
[3H]methoxyfenoterol binding assay to determine the relative amount Coimmunoprecipitation. HEK293 cells stably expressing FLAG- of b2AR in active conformations in the absence and presence of b2AR were transfected with pcDNA-HA-intrabodies and treated with nanobodies. We based this approach on the allosteric principle that vehicle (DMSO) or 10 mM isoproterenol (ISO) for 15 minutes before binding of agonist and transducer to distinct sites on a GPCR scraping cells in MNG-containing lysis buffer (as described earlier).
reciprocally enhances one another's affinity for the receptor. Thus, Cells were lysed while rotating at 4°C for 1 hour, and insoluble material agonists possess both low affinity for the uncoupled receptor and high was separated by centrifugation at 14,000g for 15 minutes. FLAG-b2AR affinity for the transducer-coupled receptor (DeLean and Lefkowitz, was immunoprecipitated via FLAG-M2 beads (Sigma-Aldrich), and 1980; Gurevich et al., 1997). More generally, this principle applies to intrabodies were detected using a HA-tag–specific antibody.
other modulators of GPCR function, including nanobodies. For Flow Cytometry. Sf9 cells were infected with a baculovirus example, the binding of Nb80 to the b2AR increased agonist affinity encoding an N-terminal FLAG-tagged b2AR construct or a control by 95-fold and was comparable to the 100-fold shift observed with Gas virus. Three days postinfection, cells were resuspended in assay (Rasmussen et al., 2011a). Based on the previous report that media [ESF921 media (Expression Systems, Davis, CA) containing [3H]methoxyfenoterol binds the active b2AR with ∼100-fold greater 2.5 mM CaCl2 and 0.5% BSA) at a density of 8  106 cells/ml and kept affinity than the inactive b2AR (Toll et al., 2012), we posited that at 4°C for the remainder of the experiment. Cells were preincubated using [3H]methoxyfenoterol at a concentration roughly equal to its with DMSO, 1 mM ICI-118551, or 1 mM BI-167107. Purified nanobodies high affinity Kd (i.e., 4 nM) would selectively label the active pool of were diluted in assay media to a working concentration of 100 mg/ml, b2AR. Proof-of-concept experiments using a fusion between the b2AR and 20 ml of cells and 20 ml of nanobody were combined. Following a and the Gas subunit (Bertin et al., 1994) confirmed that 4 nM 1-hour incubation, cells were harvested, washed three times with 100 ml [3H]methoxyfenoterol was sensitive to increases in active b2AR of assay media, and resuspended in 20 ml of Dylight488-labeled anti– ). [3H]Methoxyfenoterol binding assays were 6 His tag antibody (1:500) (Abcam, Cambridge, MA). In parallel, performed on HEK293 and Sf9 cell membranes in the absence and cells that had not been incubated with nanobody were incubated with presence of nanobody exactly as described earlier.
Dylight488-labeled anti-FLAG M1 antibody (10 mg/ml). Following a cAMP Assays. A GloSensor cAMP biosensor (Promega, Madison, 1-hour incubation, cells were washed three times with 100 ml of assay WI) which contains a modified form of firefly luciferase was used to media and resuspended in 100 ml of media containing SYTOX indirectly measure G protein activation (Fan et al., 2008). In brief, AADvanced Dead Cell Stain (Life Technologies, Carlsbad, CA). Flow enzyme complementation as a result of cAMP binding to the cytometry data were collected on a FACSCantoII flow cytometer (BD GloSensor biosensor results in luminescence following incubation Biosciences, Carlsbad, CA) and analyzed using CyFlogic software with a luciferase substrate. HEK293 cells were plated at 35,000 in 96- (CyFlo Ltd., Kirkkonummi, Finland).
well dishes, and 24 hours thereafter, each well was transiently Competition Radioligand Binding Assays. Competition radio- transfected with 10 ng of GloSensor biosensor and 40 ng of pcDNA- ligand binding assays were performed on both freshly isolated whole HA-intrabody using the Fugene6 transfection reagent (Roche). Cells cells and frozen membranes. Briefly, HEK293 cells expressing the were incubated with GloSensor reagent for 90 minutes at 28°C 48 hours post-transfection and then treated with a dose response of ISO 2AR were harvested using a 0.05% EDTA solution (Sigma-Aldrich) and collected via centrifugation at 500g for 1 minute. The cells were for 10 minutes. Luminescence was measured using a NOVOstar then washed and resuspended in cold whole-cell binding buffer microplate reader (BMG Labtech, Ortenberg, Germany).
(minimum Eagle's medium and 20 mM HEPES, pH7.5) prior to the b-Arrestin Recruitment. The recruitment of b-arrestin to the assay. Purified membrane stocks were prepared from b 2AR was assessed using the Tango Assay as previously described ing Sf9 or HEK293 cells via differential centrifugation. The cells were (Barnea et al., 2008). To amplify b-arrestin recruitment, b2AR with first washed with cold phosphate-buffered saline and then dounce C-terminal tail replaced with that of the vasopressin-2-receptor (b2V2) homogenized (100 strokes on ice) in cold homogenization buffer (Rajagopal et al., 2011). HEK293-T cells stably expressing a tetracy- [75 mM Tris-HCl, pH 7.4, 2 mM EDTA, and protease inhibitor cocktail cline transactivator (tTA) protein driven luciferase reporter and (Roche)]. The cell debris was pelleted at 500g for 10 minutes at 4°C, b-arrestin-2 fused to the tobacco etch virus (TEV) protease were and the microsomal membrane fraction was subsequently recovered plated at 35,000 in 96-well dishes and transiently transfected with 40 from the supernatant via centrifugation at 35,000g for 1 hour at 4°C.
ng of pcDNA-HA-intrabody and 10 ng of b2V2 followed by a TEV The P2 membrane pellet was resuspended in homogenization buffer protease site and tTA transcription factor. Upon agonist stimulation, plus 12.5 mM MgCl recruitment of b-arrestin–TEV leads to cleavage of the tTA fused to 2, aliquoted, and stored at 280°C until further use.
Pilot studies ensured that less than 10% of the radioligand input was b2V2, resulting in nuclear translocation and transcription of the bound in all assays.
luciferase reporter. Cells were treated with a dose response of ISO 36 Whole-cell binding assays contained 1 nM [3H]CGP-12177A and hours post-transfection, and the Bright-Glo luciferase substrate either isoproterenol (0.01 nM to 100 mM) or 10 mM propranolol (Promega) was added 16 hours thereafter.
(nonspecific binding) diluted in cold whole-cell binding buffer.
Equilibrium was reached by incubating the 96-well plates at 4°Cfor 4 hours. Purified membrane binding assays contained 60 pM [125I]iodocyanopindolol, 10 nM [3H]dihydroalprenolol, or 4 nM[3H]methoxyfenoterol and either isoproterenol (0.01 nM to To test whether intracellular expression of Nbs could be 100 mM) or 10 mM propranolol (nonspecific binding) diluted in assay used as a novel tool to modulate receptor function, we set out buffer (50 mM Tris-HCL, pH 7.4, 2 mM EDTA, 12.5 mM MgCl2, to characterize a panel of nanobodies previously found to 0.05% BSA). Equilibrium was reached by incubating the 96-well specifically bind the b2AR. In brief, these nanobodies were plates at room temperature for 90 minutes. When required, nano- obtained by immunizing one llama (L. glama) with b bodies were included at a final concentration of 1 mM. Binding assays reconstituted in lipid vesicles bound to the high affinity agonist were terminated by rapid filtration onto GF/B glass-fiber filters andwashing with 8 ml of cold binding buffer using a harvester (Brandel, BI-167107 (Rasmussen et al., 2011a). Sequence alignment Gaitherburg, MD). Bound [125I] was quantified using a Packard placed the 18 unique nanobody clones into four distinct families Cobra Quantum gamma counter (Packard, San Diego, CA), and [A, B, C, and miscellaneous (MISC)] based on complementarity bound [3H] was quantified on a Tri-Carb 2800 liquid scintillation determining region 3 (CDR3) conservation (Fig. 1A). Nanobodies

Conformationally Selective Intrabodies Regulate b2AR Function antagonists (ICI-118551, Carazolol), respectively ). Although family A Nbs could bind to the activeBI-167107–occupied b2AR, they clearly favored the inactiveICI-118551–occupied b2AR (Fig. 1B). These data indicate thatall nanobodies screened have a preference for binding specificactive (families B, C, and MISC) or inactive (family A) b2ARconformations. Moreover, the observation that occupancy of theb2AR by BI-167107 or ICI-118551 increased Nb bindingsuggests they bind to an allosteric site distinct from theorthosteric binding pocket. We next assessed the ability ofNbs to stabilize active or inactive b2AR conformations bymeasuring their respective abilities to increase or decreasebinding of a radiolabeled b2AR agonist, [3H]methoxyfenoterol(Toll et al., 2012). It has long been established that allosterictransducers such as G proteins and b-arrestins promote highaffinity agonist binding by stabilizing active receptor conforma-tions (Williams and Lefkowitz, 1977; DeLean and Lefkowitz,1980). Based on this premise, we selectively labeled the activepool of b2AR using a low concentration of [3H]methoxyfenoterol(i.e., 4 nM; see Materials and Methods for details). As shown in[3H]methoxyfenoterol binding was en-hanced upon stabilization of a b2AR high affinity state inducedby G protein binding. When tested in this assay, the majority ofnanobodies in families B, C, and MISC significantly increased[3H]methoxyfenoterol binding relative to the control Nb30 (Fig.
2). This is consistent with their preferences for binding activeb2AR conformations (Fig. 1B). By contrast, family A nanobodiesmoderately, but significantly, decreased [3H]methoxyfenoterolbinding, which was in good agreement with their preference forthe inactive receptor (Fig. 1B). Taken together, these datasuggest that family A nanobodies stabilize inactive b2AR con-formations, whereas families B, C, and MISC stabilize active Fig. 1. Identification of conformationally selective b2AR nanobodies. (A)Classification of b b2AR conformations.
2AR nanobodies based on CDR3 conservation. Nano- bodies with a divergent CDR3 were categorized as MISC. (B) ELISA assay We next used flow cytometry and Sf9 insect cells expressing describing nanobody selectivity for active agonist-bound (BI-167107) or FLAG-b2AR to determine whether the nanobodies bound inactive antagonist-bound (ICI-118551) b2AR. Using immobilized nano- intracellular or extracellular b body, the relative capture of BI-167107 2AR epitopes. As a consequence –b2AR was subtracted from that derived with ICI-118551–b2AR; values greater than 0 (blue bars) denote of baculovirus infection, we observed permeable and non- nanobodies that preferentially bound BI-167107–b2AR, whereas negative permeable cells expressing FLAG-b2AR at similar levels as values represent preference for ICI-118551–b2AR. The absence of nano- shown by FLAG-antibody staining (Fig. 3, top panels).
body (—) and Nb30 were negative controls. T-tests were performed todetermine the significance between each nanobody and (—) (*P , 0.05).
However, all nanobodies from the MISC group and represen-tative nanobodies (see for all nanobodies)from families A (Nb60), B (Nb80), and C (Nb82) specifically from all four families were subsequently purified from E. coli labeled only permeabilized cells, indicating that they bind and tested in an ELISA assay to characterize their propensity to intracellular b2AR epitopes (Fig. 3, middle and bottom bind agonist- or antagonist-occupied b2AR. Consistent with the panels). Importantly, nanobodies did not label permeable or demonstrated ability for Nb80 to bind activated b2AR (Rasmus- nonpermeable cells infected with a control virus sen et al., 2011a), nanobodies in family B showed a clear preference for agonist (BI-167107)-occupied b2AR when com- Given that all nanobodies bound intracellular epitopes, we pared with the inverse agonist (ICI-118551)-occupied b2AR (Fig.
next assessed their ability to modulate receptor-dependent 1B). Similar results were obtained for Nb families C and MISC, signaling by transiently expressing them as intrabodies in although their preferences for the activated receptor were more HEK293 cells. Due to its well established selectivity for variable (Fig. 1B). Importantly, the control nanobody (Nb30) agonist-activated b2AR (Rasmussen et al., 2011a), nanobody that was obtained in a separate immunization using a different 80 was initially chosen to test whether intracellular expression antigen did not recognize the b2AR regardless of ligand of nanobodies as intrabodies compromised their selectivity for binding specific receptor conformations. Intrabody 30 (Ib30) To confirm that these nanobodies are truly stabilizing an and Ib80, when expressed in HEK293 cells, had negligible active receptor state and not just a unique conformation specific effects on the total and surface expression of FLAG-b2AR as to BI-167107, we measured Nb80 binding to receptor by ELISA assessed by immunoblotting (Fig. 4A) and radioligand binding in the presence of various b2AR antagonists and agonists. Nb80 using the noncell-permeable antagonist radioligand [3H]CGP- robustly bound to agonist (BI-167107, ISO, and formoterol)- 12177A (Fig. 4B). Importantly, Ib80, but not Ib30, selectively occupied b2AR, but this binding was significantly reduced or coimmunoprecipitated with FLAG-b2AR following stimulation eliminated in the presence of a partial agonist salbutamol or with the agonist ISO (Fig. 4C). Taken together, these data

Staus et al.
Fig. 2. Nanobodies allosterically stabilize active or inactive b2AR conformations. Sf9 insect cell membranes expressingFLAG-b2AR were incubated with 4 nM [3H]methoxyfeno-terol and 1 mM Nb in the absence (total binding) or presenceof 10 mM propranolol (nonspecific). Specific binding wasdetermined by subtracting nonspecific from total bindingand normalized relative to Nb80. The absence of nanobody(—) and Nb30 were negative controls. t tests were performedto determine the significance between each nanobody and(—) (*P , 0.05).
demonstrate that nanobodies can be expressed as intrabodies, when compared with the Nb30 and empty vector controls (Fig.
and that their remarkable selectivity for specific receptor 6D). This suggested that the large inhibitory effects of these conformations is conserved.
family A nanobodies on receptor signaling may therefore be due Next, all nanobodies that stabilized an active b2AR confor- to stabilization of specific receptor conformations or a reduction mation (families B, C, and MISC; Fig. 1) were tested as in receptor expression, or a combination of both factors.
intrabodies for their potential to modulate b2AR-dependent Interestingly, we observed that several members of each signaling. Intrabody expression varied extensively, but these nanobody family were more effective at inhibiting b-arrestin differences had little effect on b2AR expression (Fig. 5, A–C, left recruitment than cAMP generation (Figs. 5D and 6D). To rule panel). G protein activation and b-arrestin recruitment were out the possibility that the b-arrestin recruitment assay was measured in HEK293 cells using luminescence-based strategies more sensitive to inhibition than the cAMP assay, we measured (see Materials and Methods for details). Using these assays, we the level of assay amplification in both assays. As shown in found that approximately half of the intrabodies had significant partial agonists elicited similar sub- yet variable inhibitory effects on G protein activation and maximal responses for both b-arrestin recruitment and cAMP b-arrestin recruitment (Fig. 5, A–C, middle and right panels).
accumulation, suggesting that both assays were equally coupled.
The reductions in the maximal effect (Emax) of ISO in both G Thus, variations in assay amplification could not explain the protein activation (cAMP) and b-arrestin recruitment induced differential inhibitory effects of intrabodies such as Ib71.
by intrabody expression were calculated and summarized in Given its high expression and marked inhibitory effects on both G protein activation and b-arrestin recruitment assays When tested in the same assays, the majority of intrabodies (Fig. 5), we focused on Ib71 to further investigate the effects that stabilized an "inactive" b2AR conformation (family A; Fig.
of intrabody expression on b2AR-dependent signaling. Con- 1) significantly inhibited G protein activation and b-arrestin sistent with our earlier findings, Ib71had no effect on recep- recruitment, although to varying levels (Fig. 6, B–D). Unlike tor expression (Fig. 7A), selectively coimmunoprecipitated family B, C, and MISC intrabodies, expression of several family with FLAG-b2AR after ISO treatment (Fig. 7B), and stabi- A intrabodies (i.e., Ib60 and Ib61) reduced b2AR expression lized a b2AR high affinity state as assessed by whole-cell Fig. 3. Nanobodies bind specifically to intracellular epito-pes of the b2AR. Sf9 insect cells were infected witha baculovirus encoding FLAG-b2AR resulting in cellpopulations that were partially permeabilized due to viralinfection. b2AR-expressing cells were preincubated with1 mM ICI-118551 (family A nanobodies) or 1 mM BI-167107(families B, C, and MISC). Binding of purified His-taggednanobodies to cells was detected with a DyLight488-labeledanti–6 His antibody. FLAG-M1 antibody was labeled withDyLight488. Singlet cells were gated into intact andpermeable populations based on staining with SYTOXAADvanced Dead Cell Stain.

Conformationally Selective Intrabodies Regulate b2AR Function Fig. 4. Intrabody 80 expression and specificity for activated b2AR. (A) Immunoblotting (IB) of HEK293 cells transiently transfected with FLAG-b2ARand pcDNA, HA-Ib30, or Ib80. (B) HEK293 cells were transfected as described earlier, and receptor expression was assessed via whole-cell binding using[3H]CGP-12177A. Specific binding normalized to pcDNA. (C) HEK293 cells stably expressing FLAG-b2AR were transfected with HA-Ib30 or Ib80,stimulated with the agonist ISO for 15 minutes, and then solubilized in lysis buffer. FLAG-b2AR was immunoprecipitated (IP) using FLAG beads, theeluate was subjected to SDS-PAGE, and intrabody was detected using an HA antibody.
competition binding experiments (Fig. 7C). Since b-arrestin One of the major goals of this study was to explore the role recruitment is known to be highly dependent on GRK of nanobodies in modulating receptor function by expressing phosphorylation of the b2AR C-terminal tail, we set out to them as intrabodies in mammalian cells. Unlike the case for determine if GRK-mediated receptor phosphorylation is altered traditional antibodies and antibody fragments which require in the presence of Ib71. As shown in Fig. 7D, dose-dependent proper folding of multiple domains, we hypothesized that the phosphorylation of Serine355 and Serine356 (Ser355/356) unique single-domain nature of nanobodies would allow for (canonical GRK5/6 phosphorylation sites) on the b2AR was their functional expression in the reducing cytoplasmic envi- strongly inhibited by Ib71 in comparison with Ib30 or the empty ronment. We found that the active state nanobody-derived vector control. To further validate the inhibition of b-arrestin intrabodies are selectively recruited to the b2AR upon agonist recruitment by Ib71, we conducted b2AR–b-arrestin cross-linking treatment, resulting in inhibition of both G protein activation and green fluorescent protein–b-arrestin-2 recruitment ex- and b-arrestin recruitment. Unlike modulators that bind linear periments in live cells. Cross-linking studies demonstrated epitopes, the remarkable selectivity of these intrabodies for that Ib71 markedly decreased the amount of b-arrestin specific b2AR conformations may reduce the probability of recruited to the b2AR after isoproterenol treatment when having off-target effects within the cell. Furthermore, in compared with the empty vector or Ib30 controls (Fig. 7E).
addition to directly modulating receptor function, intrabodies Furthermore, Ib71, but not Ib30, blocked the recruitment of were recently used to monitor the activation state of the b2AR green fluorescent protein–b-arrestin-2 to immunoreactive and its cognate G protein in live cells (Irannejad et al., 2013).
puncta containing the b2AR following ISO stimulation as Taken together, using intrabodies as tools to study GPCR assessed by confocal microscopy (Fig. 7F). Taken together, biology will likely extend well beyond this study.
these data demonstrate that Ib71 is a powerful inhibitor of There are likely many different mechanisms by which these b-arrestin recruitment to the b2AR, presumably exerting this intrabodies can inhibit b2AR signaling. Since several studies effect by blocking receptor phosphorylation.
have recently highlighted the ability of an agonist-boundGPCR to reside in an array of conformations (Ghanouni et al.,2001; Yao et al., 2006; Kahsai et al., 2011), it is plausible that this heterogeneity would lead to nanobodies which stabilize It has been repeatedly demonstrated that targeting the a variety of distinct conformations. Therefore, stabilization of biologic activity of GPCRs has tremendous therapeutic specific conformations that are not conducive to effector potential given their indispensable roles in regulating a vast coupling would result in inhibition of receptor signaling. This array of physiological and pathological processes. Although is likely the mode of inhibition seen with intrabodies which most studies have focused on using orthosteric ligands, the stabilize an inactive receptor state (family A). However, we use of allosteric modulators to further fine-tune receptor cannot rule out the possibility that other intrabody families function has become of recent interest (Conn et al., 2009; may stabilize specific conformational states that fail to couple Wang et al., 2009; Wang and Lewis, 2013). Herein, we to downstream effectors. Second, intrabody recruitment to the explored the ability of a panel of closely related single-domain receptor following agonist stimulation could sterically block Camelid heavy-chain antibodies (nanobodies) to allosterically the binding of G protein and/or b-arrestin. This is most target and stabilize distinct agonist-bound ("active") and certainly the case with Ib80 since recent crystallographic antagonist-bound ("inactive") b2AR conformations. Our stud- findings demonstrate that the binding epitope and b2AR ies uncovered four families of nanobodies with differing conformation stabilized by both Nb80 and the heterotrimeric abilities to stabilize active or inactive b2AR conformations.
G protein complex are nearly identical (Rasmussen et al., Subsequent conversion of these nanobodies to intrabodies 2011a,b). Although the receptor binding interface between revealed a variety of effects on cAMP accumulation and b-arrestin and nanobodies other than Nb80 is not yet known, b-arrestin recruitment, supporting their utility as novel tools steric occlusion could explain the inhibitory effects of intra- to study GPCR biology.
bodies from families B, C, and MISC.

Staus et al.
Fig. 5. Regulation of b2AR functions by "active" state stabilizing intrabodies. Receptor expression (A), G protein–mediated cAMP levels (GloSensor) (B),and b-arrestin recruitment (Tango Assay) (C) was measured for intrabody family B, C, and MISC. (A) Immunoblot analysis of HEK293 cells transientlytransfected with FLAG-b2AR and the indicated HA-Intrabody (Ib). Tubulin was used to ensure equal total protein loading. (B) HEK293 cells weretransfected with the GloSensor cAMP biosensor (Promega) and pcDNA empty vector or individual HA-intrabodies, stimulated with a dose response ofisoproterenol (ISO), and luminescence measured 10 minutes thereafter. Data were analyzed using GraphPad Prism program with sigmoidal doseresponse curve fit and normalized to 100% pcDNA empty vector. (C) HEK293T cells stably expressing b-arrestin-2 fused to the Tobacco Etch Virus (TEV)protease and a tTA transcription factor driven luciferase reporter were transiently transfected with b2AR fused to the tTA transcription factor, butseparated by a TEV cleavage site and the indicated HA-intrabody. Cells were stimulated with a dose response of isoproterenol, and luminescence wasmeasured 16 hours thereafter. Data were normalized as described in C. (D) The maximal response (Emax) for cAMP and b-arrestin followingisoproterenol treatment in presence of the indicated intrabody as determined by nonlinear regression analysis. Data were normalized to 100% pcDNA.
T-tests were used to compare each intrabody to pcDNA control (*P , 0.05), underlined • denotes significance between Bmax of Glosensor and Tango assays for each individual intrabody

Conformationally Selective Intrabodies Regulate b2AR Function Fig. 6. Intrabodies that stabilize "inactive" b2AR conformation(s) inhibit G protein activation and b-arrestin recruitment. The effects of intrabodyfamily A on expression of b2AR (A), G protein activation (B), and b-arrestin recruitment (C) were analyzed as described in Fig. 4. (D) The maximalresponse (Emax) for cAMP and b-arrestin following isoproterenol treatment in the presence of indicated intrabody as determined by nonlinear regressionanalysis. Data were normalized to 100% pcDNA. t tests were used to compare each intrabody to pcDNA control (*P , 0.05); underlined • denotes significance between Bmax of GloSensor and Tango assays for each individual intrabody.
Nanobodies in families B, C, and MISC were shown to signaling arms were measured using different assay platforms, stabilize an active receptor conformation (Figs. 1B and 2), the quantification of such intrabody bias will need to be further which could result in chronic receptor activation in the investigated given the confounding variables of receptor, absence of agonist, leading to desensitization and/or receptor intrabody, and effector expression. Such analysis will likely internalization. Given that we did not observe any decreased require the development of novel assays to quantitatively levels of receptor expression upon intrabody expression (Figs.
measure G protein activation and b-arrestin recruitment in the 4, A and B, 5A, and 7A), together with the lack of binding of same cells. Nonetheless, despite the fact that our b-arrestin Ib80 or Ib71 to the b2AR in the absence of agonist (Figs. 4C recruitment assay used overexpression of both b2AR and and 7B), we find this possibility unlikely. Additionally, since b-arrestin (compared with endogenous receptor and G protein the b2AR can also couple to Gi (Daaka et al., 1997), we cannot in cAMP assays), many of the intrabodies (i.e., Nb63, 71, and rule out the possibility that decreases in cAMP levels seen 72) were still capable of inhibiting b-arrestin recruitment to here are mediated by modulation of this signaling pathway.
a greater extent than G protein activation. Given the current Additional studies will be required to delineate the potential findings, we cannot determine whether this biased inhibition is mechanisms by which these nanobodies regulate cAMP due to enhanced steric blockade of b-arrestin or stabilization of production and b-arrestin recruitment.
specific receptor conformations less conducive to b-arrestin The discovery that b-arrestin signaling can occur indepen- coupling in comparison with G protein. Additionally, several dently of G protein activation has led to consideration of studies have now demonstrated precoupling of receptor and G the possibility that specific receptor signaling arms can be protein which could sterically hinder nanobody binding, pharmacologically isolated, a concept which is referred to as resulting in the observed differential inhibition of b-arrestin "functional selectivity" or "biased agonism" (reviewed in Reiter recruitment and G protein activation (Nobles et al., 2005; Qin et al., 2012). Perhaps the best example of this phenomenon is et al., 2011). Furthermore, intrabody-mediated inhibition of observed with the angiotensin type 1 receptor where two biased b-arrestin recruitment may also be attenuated due to di- agonists, SII (Sar1, Ile4, Ile8-angiotensin II) and most recently minished levels of GRK-dependent receptor phosphorylation.
TRV027, selectively stimulate b-arrestin–dependent signaling Further work will be required to delineate the detailed in the absence of Gq protein activation (Wei et al., 2003; Violin molecular mechanisms governing this potential bias.
et al., 2010). Our findings suggest that numerous intrabodies Targeting the biologic functions of many receptors and have a disproportionate effect on inhibition of G protein signaling pathways in a cell type–specific manner in vivo activation or b-arrestin recruitment, implying that they may remains a challenging endeavor. More specifically, generating be partially biased (Figs. 5 and 6). However, since these two cell type–specific knockouts can be quite difficult, and localized

Staus et al.
Fig. 7. Attenuation of b-arrestin recruitment, GRK-mediated receptor phosphorylation, and b2AR internalization by intrabody 71. (A) HEK293 cellswere transfected with FLAG-b2AR and pcDNA empty vector (EV) or HA-Ib71, and cell surface expression was measured via [3H]CGP-12177Aradioligand binding. Data were normalized relative to pcDNA. (B) HA-Ib71 was transfected in HEK293 cells stably expressing FLAG-b2AR, andcoimmunoprecipitation assays were performed after treatment with DMSO (2) or ISO (+). (C) HEK293 cells expressing FLAG-b2AR and pcDNA orHA-Ib71 were subject to whole-cell binding experiments in the presence of [3H]CGP-12177A and a dose response of isoproterenol. (D) HEK293 cellstransiently expressing FLAG-b2AR and pcDNA, Ib30, or Ib71 were stimulated with a dose response of isoproterenol and analyzed for GRK-dependentphosphorylation of serine 355/6. (E) Whole-cell cross-linking of b-arrestin-1/2 with FLAG-b2AR in HEK293 cells in the presence of pcDNA, Ib30, or Ib71after stimulation with 10 mM isoproterenol. (F) U2OS cells were transiently transfected with FLAG-b2AR, green fluorescent protein–b-arrestin-2, andMyc-tagged Ib30 or Ib71, and b-arrestin recruitment and receptor internalization were visualized using immunostaining and confocal microscopy. DAPI,49,6-diamidino-2-phenylindole; IB, immunoblots; IP, immunoprecipitation.
or global antagonist treatments can have a variety of off-target Although we have focused on the use of allosteric intrabodies to effects which make data interpretation problematic, although manipulate GPCR function, these reagents could also conceiv- considerable advances have recently been made using receptor ably be used to modulate other intracellular targets. Indeed, activated solely by a synthetic ligand and designer receptor nanobodies have been described that allosterically activate or exclusively activated by designer drugs technologies (Conklin inhibit the catalytic function of specific enzymes (Saerens et al., et al., 2008). In this context, intrabody expression driven by 2004; Barlow et al., 2009; Oyen et al., 2011). Furthermore, cell type–specific promoters may provide a novel strategy to a nanobody that inhibits Clostridium botulinum neurotoxin examine the contribution of particular receptors and signaling proteases maintained its antagonist properties when expressed pathways to regulating numerous physiological and patholog- as an intrabody in neuronal cells (Tremblay et al., 2010). The ical processes. Additionally, the discovery of intrabodies that recent development of small-molecule or peptide reagents that bias signaling may also be useful in dissecting the influence of facilitate efficient delivery of biologically active proteins across specific signaling arms to downstream receptor-mediated cell membranes could be used to deliver intrabodies, thereby events in vivo. Given the recent discovery of a nanobody that extending their use to acutely regulate protein function in live stabilizes the active state of the M2 muscarinic acetylcholine cells (Milletti, 2012). Although all nanobodies discussed herein receptor (Kruse et al., 2013), the use of nanobodies to modulate bind to intracellular receptor epitopes, the identification of receptor function will likely extend well beyond this study.
nanobodies that modulate receptor function by binding to Conformationally Selective Intrabodies Regulate b2AR Function extracellular epitopes as orthosteric or allosteric ligands may Lagerström MC and Schiöth HB (2008) Structural diversity of G protein-coupled receptors and significance for drug discovery. Nat Rev Drug Discov 7:339–357.
provide very useful therapeutic agents.
Lo AS, Zhu Q, and Marasco WA (2008) Intracellular antibodies (intrabodies) and In conclusion, our data demonstrate that nanobody-derived their therapeutic potential. Handbook Exp Pharmacol (181):343–373.
intrabodies function as novel regulators of b Milletti F (2012) Cell-penetrating peptides: classes, origin, and current landscape.
Drug Discov Today 17:850–860.
protein activation and b-arrestin recruitment. These innova- Muyldermans S (2013) Nanobodies: natural single-domain antibodies. Annu Rev tive reagents will undoubtedly be powerful tools for furthering Neves SR, Ram PT, and Iyengar R (2002) G protein pathways. Science 296: our understanding of GPCR biology.
Nobles M, Benians A, and Tinker A (2005) Heterotrimeric G proteins precouple with G protein-coupled receptors in living cells. Proc Natl Acad Sci USA 102: The authors thank J. Wisler, J. Violin, and A. Shukla for helpful Oyen D, Srinivasan V, Steyaert J, and Barlow JN (2011) Constraining enzyme con- discussions, and G. Kweon, X. Zhu, X. Jiang, and D. Capel for formational change by an antibody leads to hyperbolic inhibition. J Mol Biol 407:138–148.
technical assistance. The authors thank Dr. Irving Wainer (Labora- Qin K, Dong C, Wu G, and Lambert NA (2011) Inactive-state preassembly of G(q)- tory of Clinical Investigation, National Institute on Aging Intramural coupled receptors and G(q) heterotrimers. Nat Chem Biol 7:740–747.
Research Program, Baltimore, MD) for assistance with the Rajagopal S, Ahn S, Rominger DH, Gowen-MacDonald W, Lam CM, Dewire SM, Violin JD, and Lefkowitz RJ (2011) Quantifying ligand bias at seven- H-methoxyfenoterol studies and Q. Lennon and D. Addison for transmembrane receptors. Mol Pharmacol 80:367–377.
excellent secretarial assistance.
Rasmussen SG, Choi HJ, Fung JJ, Pardon E, Casarosa P, Chae PS, Devree BT, Rosenbaum DM, Thian FS, and Kobilka TS et al. (2011a) Structure of a nanobody-stabilized active state of the b(2) adrenoceptor. Nature 469:175–180.
Authorship Contributions Rasmussen SG, DeVree BT, Zou Y, Kruse AC, Chung KY, Kobilka TS, Thian FS, Participated in research design: Staus, Wingler, Strachan, Ahn, Chae PS, Pardon E, and Calinski D et al. (2011b) Crystal structure of the b2 Kobilka, Lefkowitz.
adrenergic receptor-Gs protein complex. Nature 477:549–555.
Reiter E, Ahn S, Shukla AK, and Lefkowitz RJ (2012) Molecular mechanism of Conducted experiments: Staus, Wingler, Strachan.
b-arrestin-biased agonism at seven-transmembrane receptors. Annu Rev Phar- Contributed new reagents or analytic tools: Rasmussen, Pardon, macol Toxicol 52:179–197.
Kobilka, Steyaert.
Saerens D, Kinne J, Bosmans E, Wernery U, Muyldermans S, and Conrath K (2004) Single domain antibodies derived from dromedary lymph node and peripheral Performed data analysis: Staus, Wingler, Strachan.
blood lymphocytes sensing conformational variants of prostate-specific antigen. J Wrote or contributed to the writing of the manuscript: Staus, Biol Chem 279:51965–51972.
Wingler, Lefkowitz.
Shenoy SK, Drake MT, Nelson CD, Houtz DA, Xiao K, Madabushi S, Reiter E, Pre- mont RT, Lichtarge O, and Lefkowitz RJ (2006) beta-arrestin-dependent, G protein-independent ERK1/2 activation by the beta2 adrenergic receptor. J BiolChem 281:1261–1273.
Barlow JN, Conrath K, and Steyaert J (2009) Substrate-dependent modulation of en- Shenoy SK and Lefkowitz RJ (2011) b-Arrestin-mediated receptor trafficking and zyme activity by allosteric effector antibodies. Biochim Biophys Acta 1794:1259–1268.
signal transduction. Trends Pharmacol Sci 32:521–533.
Barnea G, Strapps W, Herrada G, Berman Y, Ong J, Kloss B, Axel R, and Lee KJ Shukla AK, Xiao K, and Lefkowitz RJ (2011) Emerging paradigms of b-arrestin- (2008) The genetic design of signaling cascades to record receptor activation. Proc dependent seven transmembrane receptor signaling. Trends Biochem Sci 36: Natl Acad Sci USA 105:64–69.
Benovic JL, Kühn H, Weyand I, Codina J, Caron MG, and Lefkowitz RJ (1987) Steyaert J and Kobilka BK (2011) Nanobody stabilization of G protein-coupled re- Functional desensitization of the isolated beta-adrenergic receptor by the beta- ceptor conformational states. Curr Opin Struct Biol 21:567–572.
adrenergic receptor kinase: potential role of an analog of the retinal protein Toll L, Pajak K, Plazinska A, Jozwiak K, Jimenez L, Kozocas JA, Tanga MJ, Bupp arrestin (48-kDa protein). Proc Natl Acad Sci USA 84:8879–8882.
JE, and Wainer IW (2012) Thermodynamics and docking of agonists to the b(2)- Bertin B, Freissmuth M, Jockers R, Strosberg AD, and Marullo S (1994) Cellular adrenoceptor determined using [(3)H](R,R')-4-methoxyfenoterol as the marker li- signaling by an agonist-activated receptor/Gs alpha fusion protein. Proc Natl Acad gand. Mol Pharmacol 81:846–854.
Sci USA 91:8827–8831.
Tremblay J.M., Kuo C.L., Abeijon C., Sepulveda J., Oyler G., Hu X., Jin M.M., Conklin BR, Hsiao EC, Claeysen S, Dumuis A, Srinivasan S, Forsayeth JR, Guettier and Shoemaker C.B. (2010). Camelid single domain antibodies (VHHs) as neuronal JM, Chang WC, Pei Y, and McCarthy KD et al. (2008) Engineering GPCR signaling cell intrabody binding agents and inhibitors of Clostridium botulinum neurotoxin pathways with RASSLs. Nat Methods 5:673–678.
(BoNT) proteases. Toxicon 56:990–998.
Conn PJ, Christopoulos A, and Lindsley CW (2009) Allosteric modulators of GPCRs: Vincke C and Muyldermans S (2012) Introduction to heavy chain antibodies and a novel approach for the treatment of CNS disorders. Nat Rev Drug Discov 8:41–54.
derived Nanobodies. Methods Mol Biol 911:15–26.
Daaka Y, Luttrell LM, and Lefkowitz RJ (1997) Switching of the coupling of the beta2- Violin JD, DeWire SM, Yamashita D, Rominger DH, Nguyen L, Schiller K, Whalen adrenergic receptor to different G proteins by protein kinase A. Nature 390:88–91.
EJ, Gowen M, and Lark MW (2010) Selectively engaging b-arrestins at the an- DeLean A and Lefkowitz RJ (1980) Dihydroergocryptine binding and alpha- giotensin II type 1 receptor reduces blood pressure and increases cardiac perfor- adrenoreceptors in smooth muscle. Nature 283:109–110.
mance. J Pharmacol Exp Ther 335:572–579.
Fan F, Binkowski BF, Butler BL, Stecha PF, Lewis MK, and Wood KV (2008) Novel Wang CI and Lewis RJ (2013) Emerging opportunities for allosteric modulation of genetically encoded biosensors using firefly luciferase. ACS Chem Biol 3:346–351.
G-protein coupled receptors. Biochem Pharmacol 85:153–162.
Ghanouni P, Gryczynski Z, Steenhuis JJ, Lee TW, Farrens DL, Lakowicz JR, Wang L, Martin B, Brenneman R, Luttrell LM, and Maudsley S (2009) Allosteric and Kobilka BK (2001) Functionally different agonists induce distinct con- modulators of g protein-coupled receptors: future therapeutics for complex physi- formations in the G protein coupling domain of the beta 2 adrenergic receptor. J ological disorders. J Pharmacol Exp Ther 331:340–348.
Biol Chem 276:24433–24436.
Wei H, Ahn S, Shenoy SK, Karnik SS, Hunyady L, Luttrell LM, and Lefkowitz RJ Gupta A, Heimann AS, Gomes I, and Devi LA (2008) Antibodies against G-protein (2003) Independent beta-arrestin 2 and G protein-mediated pathways for angio- coupled receptors: novel uses in screening and drug development. Comb Chem tensin II activation of extracellular signal-regulated kinases 1 and 2. Proc Natl High Throughput Screen 11:463–467.
Acad Sci USA 100:10782–10787.
Gurevich VV, Pals-Rylaarsdam R, Benovic JL, Hosey MM, and Onorato JJ (1997) Williams LT and Lefkowitz RJ (1977) Molecular pharmacology of alpha adrenergic Agonist-receptor-arrestin, an alternative ternary complex with high agonist af- receptors: utilization of [3H]dihydroergocryptine binding in the study of pharma- finity. J Biol Chem 272:28849–28852.
cological receptor alterations. Mol Pharmacol 13:304–313.
Irannejad R, Tomshine JC, Tomshine JR, Chevalier M, Mahoney JP, Steyaert J, Yao X, Parnot C, Deupi X, Ratnala VR, Swaminath G, Farrens D, and Kobilka B Rasmussen SG, Sunahara RK, El-Samad H, and Huang B et al. (2013) Confor- (2006) Coupling ligand structure to specific conformational switches in the beta2- mational biosensors reveal GPCR signalling from endosomes. Nature 495:534–538.
adrenoceptor. Nat Chem Biol 2:417–422.
Kahsai AW, Xiao K, Rajagopal S, Ahn S, Shukla AK, Sun J, Oas TG, and Lefkowitz RJ (2011) Multiple ligand-specific conformations of the b2-adrenergic receptor. NatChem Biol 7:692–700.
Address correspondence to: Dr. Robert J. Lefkowitz, Duke University Kruse AC, Ring AM, Manglik A, Hu J, Hu K, Eitel K, Hübner H, Pardon E, Valant C, Medical Center, P.O. Box 3821, Durham, NC 27710. E-mail: and Sexton PM et al. (2013) Activation and allosteric modulation of a muscarinic acetylcholine receptor. Nature 504:101–106.

Source: https://cris.cumulus.vub.ac.be/portal/files/5637704/Mol_Pharmacol_2014_Staus_472_81.pdf