Chester Clinic

 

Vetrec-2014-102892 1.12

Cutaneous and renal glomerular vasculopathyas a cause of acute kidney injury in dogsin the UK L. P. Holm, I. Hawkins, C. Robin, R. J. Newton, R. Jepson, G. Stanzani, L. A. McMahon,P. Pesavento, T. Carr, T. Cogan, C. G. Couto, R. Cianciolo, D. J. Walker To describe the signalment, clinicopathological findings and outcome in dogs presenting withacute kidney injury (AKI) and skin lesions between November 2012 and March 2014, in whomcutaneous and renal glomerular vasculopathy (CRGV) was suspected and renal thromboticmicroangiopathy (TMA) was histopathologically confirmed. The medical records of dogs withskin lesions and AKI, with histopathologically confirmed renal TMA, were retrospectivelyreviewed. Thirty dogs from across the UK were identified with clinicopathological findingscompatible with CRGV. These findings included the following: skin lesions, predominantlyaffecting the distal extremities; AKI; and variably, anaemia, thrombocytopaenia andhyperbilirubinaemia. Known causes of AKI were excluded. The major renal histopathogicalfinding was TMA. All thirty dogs died or were euthanised. Shiga toxin was not identified in thekidneys of affected dogs. Escherichia coli genes encoding shiga toxin were not identified infaeces from affected dogs. CRGV has previously been reported in greyhounds in the USA,a greyhound in the UK, without renal involvement, and a Great Dane in Germany. This is thefirst report of a series of non-greyhound dogs with CRGV and AKI in the UK. CRGV is a disease ofunknown aetiology carrying a poor prognosis when azotaemia develops.
). CRGV is the only canine disease previously Cutaneous and renal glomerular vasculopathy (CRGV) is a reported to cause vasculopathy preferentially affecting the small disease of unknown aetiology, reported to cause ulceration of the vessels of the kidney and skin.
distal extremities in dogs. It is variably associated with clinically AKI can result from pre-renal (), renal relevant acute kidney injury (AKI). CRGV has been reported in greyhounds in the USA a Great and post-renal events ().
Dane in Germany () and a grey- Skin lesions are not commonly associated with AKI in dogs, hound in the UK ().
unless the AKI has resulted from immune-mediated disease The major renal histopathological lesion reported in CRGV is (certain neoplasms thrombotic microangiopathy (TMA). Thrombotic microangiopa- infectious diseases (or vascular thies are characterised by inflammation and damage to vascular events, such as vasculopathy ).
endothelium, leading to widespread formation of microthrombi The purpose of this report is to summarise the signalment, and resultant consumptive thrombocytopaenia, microangio- clinicopathological findings and outcome in 30 dogs presenting pathic haemolytic anaemia and multiorgan dysfunction ( between November 2012 and March 2014, in which CRGV wassuspected clinically and TMA was identified histopathologically.
Veterinary Record (2015) doi: 10.1136/vr.102892 L. P. Holm, BVM&S, CertSAM, C. Robin, MSc, BSc, Department of PMI, University of Couto Veterinary Consultants, Hilliard, R. J. Newton, BVSc, MSc, PhD, California, Davis, School of Veterinary L. A. McMahon, BVetMed (Hons), Medicine, 4206 VM3A, 1 Shields R. Cianciolo, VMD, PhD, DACP, DipACVIM, DipECVIM-CA, MRCVS, Animal Health Trust, Lanwades Park, Avenue, Davis, California 95616, USA International Veterinary Renal Pathology D. J. Walker, BVetMed (Hons), Kentford, Newmarket, Suffolk CB8 T. Carr, BVMS GPcert (SAM), Service, Department of Veterinary DipACVIM, DipECVIM-CA, MRCVS, Biosciences, The Ohio State University, Anderson Moores Veterinary R. Jepson, BVSc(Dist), MVetMed, Martin and Carr, The Old Wel , Station 301 Goss Laboratory, 1925 Coffey Rd, Specialists, The Granary, Bunstead PhD, DipACVIM, DipECVIM, MRCVS, Road, Pershore, Worcestershire WR10 Columbus, Ohio, USA Barns, Poles Lane, Hursley, G. Stanzani, DVM, MRCVS, E-mail for correspondence: Winchester, Hampshire SO21 2LL, UK Department of Clinical Science and T. Cogan, BSc (Exon), PhD (Exon), I. Hawkins, DVM, MRCVS, Dip ACVP, Services, Royal Veterinary College, School of Veterinary Sciences, Bridge Pathology, Horner Court, 637 Hawkshead Lane, North Mymms, University of Bristol, Langford, Bristol Provenance: Not commissioned; Gloucester Road, Horfield, Bristol BS7 Hertfordshire AL9 7TA, UK externally peer reviewed P. Pesavento, DVM, PhD, Dip ACVP, C. G. Couto, DVM, DipACVIM, Accepted January 21, 2015 10.1136/vr.102892 Veterinary Record 1 of 12 Materials and methods sections, which were then washed three times and incubated Cases were identified by comprehensive search of computerised with goat anti-mouse G1 FITC-conjugated secondary antibody.
record systems (using keywords) at two referral practices. Case Slides were viewed using a fluorescence microscope.
records were searched for the diagnosis of AKI, with subsequent PCR for Shiga toxin on renal tissue:iii DNA was extracted review of clinical case files and renal/dermal histopathology in from paraffin-embedded samples using the QIAamp®DNA FFPE order to identify cases compatible with CRGV. Further case sub- Tissue Kit (Qiagen, Hilden, Germany). PCR for verotoxin 1 and missions came from two other referral practices and 49 first 2 was then performed as previously described opinion practices. Practices became aware of CRGV through a combination of: a letter in the veterinary literature ( PCR for E. coli virulence genes on faeces:iv DNA was media reports and information on a specialist extracted from colonies of E. coli cultured from faeces (Wizard practice website. Records from suspected cases were thus Miniprep DNA purification System, Promega). Multiplex PCRs selected by the additional 51 practices both prospectively and for eaeA, stx 1 and 2, LT1 and ST1 and 2 genes were performed, retrospectively (from memory rather than via computerised as previously described ( record system searches) and were subsequently reviewed by twoof the authors (LPH, DJW). Dogs were included if they presented between November 1, 2012 and March 31, 2014 with skin Seventy-one cases of AKI with skin lesions were identified lesions and AKI with no known identifiable cause, and with within the defined time period for which there was clinical sus- renal histopathological evidence of TMA. Animals were defined picion of CRGV. Of these, 41 cases were excluded due to limited as having AKI if they had historical and laboratory evidence of investigation and/or incomplete medical records. Thirty cases kidney injury with or without clinical oligoanuria (International met the inclusion criteria as affected cases with confirmed TMA on renal histopathology.
Clinicopathological data are reported as median and range.
Signalment, history and clinical signs Breeds represented were English springer spaniel (n=5), cross- Representative sections from skin, kidney and other organs, breed above 20 kg (n=4), flat coated retriever (n=4), whippet where possible, were paraffin embedded. Sections of 3–4 μm (n=3), border collie (n=2), Jack Russell terrier (n=2), Doberman were prepared from each of the tissues via microtome and (n=2) and one each of, Labrador retriever, cocker spaniel, affixed to lysine-charged glass slides. These were stained by standard technique with haematoxylin and eosin. In addition, Dalmatian, Tibetan terrier and crossbreed below 20 kg. Median sections of the kidney were also stained with Warthin-Starry age was 4.90 years (1.00–11.75 years). Ten were male neutered, silver stain and Periodic Acid Schiff. Kidneys from three dogs seven were female neutered, six were male entire and seven were were also stained with Masson's trichrome and Jones female entire. Median weight was 23.2 kg (7.3–40.4 kg, n=28).
Methenamine silver method.
Affected cases were identified from multiple areas of north- All of the renal histopathology was reviewed by a single vet- ern and southern England (). Ten dogs had been in the New erinary pathologist (IH). Renal samples from three dogs were Forest National Park shortly (four hours to 14 days) before devel- also submitted to a second veterinary pathologist (RC).
oping skin lesions and/or becoming unwell.
PCR for pathogenic Leptospira spp.i was carried out on sec- Over the first 12 months of the study period (November 1, tions of kidney and liver using an amplification mixture as previ- 2012–October 31, 2013), confirmed cases presented in November ously described ). DNA was amplified (n=2), December (n=2), February (n=4), March (n=1) and May and detected on a Stratagene Mx3005P qPCR system, using a (n=1). The remaining 20 confirmed cases presented between program of 95°C for 10 minutes followed by 50 cycles of 95°C November 1, 2013 and March 31, 2014.
for 30 seconds and 57°C for 60 seconds.
Twenty dogs were vaccinated within the past year (vaccines Fluorescence in situ hybridisation (FISH) for pathogenic bac- used included distemper, D; hepatitis, H; leptospirosis, L; parvo- teriai was performed on de-waxed tissue sections (kidney and virus, P; and parainfluenza, Pi: DHLPPi n=10; DHPPi n=1; LP liver) using fluorescently labelled probes. Eubacteria were n=1; DHLP n=2; L n=3; LPi n=2; type not recorded n=1), eight detected using a mixture of three probes: GCTGCCTCCCG were unvaccinated and vaccinal status was unknown in two dogs.
TAGGAGT, GCAGCCACCCGTAGGTGT and GCTGCCACCCG Skin lesions commonly appeared before signs of systemic TAGGTGT. Leptospira were detected using probe CGGGTGCT illness (lethargy, malaise, anorexia, vomiting, pyrexia; n=19).
CCCCACTCAG. Escherichia coli were detected using probe Median time from development of skin lesions to diagnosis of AKI was four days (1–9 days). Nine dogs had systemic signs con- Viral metagenomicsii was performed on fresh kidney tissue, current with skin lesions and two dogs were systemically ill liver and lymph node by random nucleic acid amplification after before developing skin lesions. The management of skin lesions enrichment for viral particles, followed by DNA sequencing and before the development of AKI was variable: no medication similarity searches (Illumina MiSeq library) for sequences related (n=7), NSAIDs alone (n=3), antibiotic alone (amoxicillin- to those of known viruses ( clavulanate n=4; marbofloxacin n=1) or a combination of PCR for Dog Circovirus was performed on splenic tissueii ( par- NSAIDs or dexamethasone, and antibiotic (n=12). Information affin embedded samples and fresh frozen tissue) as previously regarding previous medications was unavailable for three cases.
described ().
With the exception of NSAIDs, none of the dogs had known FISH for Dog Circovirusi was performed on kidney tissue access to nephrotoxins before initial presentation.
using probe CTCAGACAGAGACACCGTTGCTATG as previ- Distribution of skin lesions was: distal limbs (n=28), ously described Identification of bacteria ventrum (n=9) and oral cavity/muzzle (n=10). Sixteen dogs had was made against both unstained and organism-negative more than one lesion. Fourteen had lesions in multiple locations.
The appearance of the skin lesions was highly variable, ranging FISH for Shiga toxin:i mouse anti-Shiga toxin antibody from superficial erosion through to full thickness ulceration, (diluted 1/100) was incubated overnight at 4°C on renal tissue iiiCenter for Zoonotic Diseases, Bacterial Diseases, and Antimicrobial iUniversity of Bristol Veterinary Diagnostics, School of Veterinary Resistance, Institute for Veterinary Bacteriology, University of Bern, Sciences, University of Bristol, Langford, Bristol BS40 5DU, UK.
Hochschulstrasse 4, Bern CH-3012, Switzerland.
iiPesavento Research Group, University of California, Davis, School of ivBatt Lab, University of Warwick Science Park, The Venture Centre, Sir Veterinary Medicine, 1 Shields Avenue, Davis, CA 95616, USA.
William Lyons Road, Coventry CV4 7EZ, UK.
2 of 12 Veterinary Record 10.1136/vr.102892

Location with single case Location with 2 cases FIG 1: Map to show distribution of where confirmed cases lived. (Zoomed in view shows distribution of cases in the South of England asthere were proportionally more cases from this area) with erythema, oedema and exudation ). Early lesions were days before and six days after the confirmed CRGV case that often erythematous and focal; they occasionally appeared vesicu- they lived with. All eight dogs were related to a confirmed lar, with ulceration and necrosis developing subsequently. The CRGV case and/or each other.
skin lesions were often attributed to wounds, bites, stings orfocal dermatitis. Lesion size ranged from 0.5 to 5 cm in diameter.
Six dogs developed new limb and/or oral lesions while hospita- Selected haematology, serum biochemistry, urinalysis and sys- lised. Lesions were typically painful on palpation and digital tolic blood pressure measurement results for the 30 dogs are pre- lesions often caused lameness. Oral lesions were variable but sented in , with further detail of clinicopathological were most often focal erosions or ulcers ().
abnormalities presented in . Seven dogs demonstrated The dogs' clinical signs are summarised in Pyrexia normocytic, normochromic anaemia at presentation, with a generally occurred early in the course of illness (39.8°C; further eight dogs becoming anaemic after presentation.
39.4–40.1°C) and hypothermia typically developed later in the Absolute reticulocyte count was only available for two dogs disease course (37.4°C; 36.0–37.7°C).
which were anaemic at presentation and one dog subsequently.
Fourteen dogs lived in the same household as one of the 30 The anaemia was pre- or non-regenerative (median reticulocyte confirmed CRGV cases. Of these 14 dogs, two developed skin count 22.58×109/l). Blood smear examination was performed in lesions and AKI and six developed skin lesions without AKI 13 dogs and revealed schistocytes, burr cells and/or acanthocytes (n=8). Thirteen of these 14 dogs were not part of the study in five dogs and was unremarkable in the remainder. Fifteen dogs population and the information on these dogs was obtained by were thrombocytopaenic at presentation and four became questioning owners. The eight dogs became unwell between 20 10.1136/vr.102892 Veterinary Record 3 of 12

FIG 3: (a) Tongue lesions. (b) Tongue ulcer dogs and excluded glucocorticoid deficient hypoadrenocorticism inall. Clotting times, measured in eight dogs, were not consistentwith disseminated intravascular coagulation (DIC). Six dogs hadcanine-specific pancreatic lipase immunoreactivity measured (Idexxsnap test n=4; quantitative cPLi n=2) and all had abnormal results(680 and above 1000 mg/l—reference range less than 200 mg/l).v FIG 2: All images are photographs of lesions affecting confirmed Urine dipstick and sediment examination was performed in 17 cases. (a) Superficial ulcer affecting medial thigh. (b) Deep dogs revealing: haemoglobinuria or myoglobinuria (n=16), pro- ulceration, erythema and exudation on a digit. (c) Erosion to carpal teinuria (n=11, see and glucosuria (n=6). Sediment pad, before cleaning. (d) The same lesion after clipping and cleaning At presentation, 26 dogs were azotaemic. The non-azotaemic dogs became azotaemic after initial presentation (less than vDogs were seen at numerous different veterinary practices using multiple 24 hours to six days later). Basal cortisol was measured in eight laboratories. Biochemistry reference ranges were therefore variable.
4 of 12 Veterinary Record 10.1136/vr.102892 Four dogs were tested for Dog Circovirus via PCR on splenic TABLE 1: Summary of presenting clinical signs of the 30 tissue, three via PCR on peripheral EDTA blood and six via FISH on renal tissue and all results were negative. Viral metagenomics Number of dogs affected was performed on renal tissue from two dogs; and on liver, spleen and lymph node from one of those dogs. No match was identified between viral nucleic acids enriched from those samples to known viruses.
Borrelia PCR (n=5) and Borrelia serology (n=2) results were negative. Renal heavy metal concentrations (lead, arsenic and cadmium) were measured in two dogs (Animal Health and Veterinary Laboratories Agency, Winchester) and were below reported reference intervals in both. Routine aerobic and anaer- obic bacterial culture was performed on renal tissue from three dogs and results were negative.
Faecal culture, performed in seven dogs, yielded E. coli. PCRs for E. coli virulence genes (eaeA, stx 1 and 2, LT1 and ST1 and 2) were negative in all seven, providing no evidence for infection with enteropathogenic E. coli, verotoxigenic E. coli or enterotoxi- genic E. coli.
Skin lesion cultures, performed in 11 dogs, were positive in 7, yielding Staphylococcus intermedius (n=1), Staphylococcus aureus(n=1), coagulase positive Staphylococcus (n=1), non-haemolytic examination revealed casts in nine dogs: granular (n=5), fatty Streptococcus (n=1), β haemolytic Streptococcus (n=1), Enterococcus (n=1), hyaline (n=2) and not described (n=1). Urine culture was (n=1), E. coli (n=3), Pseudomonas aeruginosa and Corynebacterium negative in 11 of 12 dogs (faecal contaminants were cultured from (n=1). Three dogs cultured more than one bacterium. Blood the remaining case). Urine toxicology was negative in five of six culture was performed in one dog and was negative.
Laboratory). Pentaethylene glycol (trace) was detected in one dog.
At presentation, nine dogs were oliguric, two were anuric Full post mortem examination was performed in five dogs by and seven had normal urine output. Urine output was unknown pathologists with a Diploma of the American or European in 13 dogs. International Renal Interest Society (IRIS) AKI College of Veterinary Pathologists, or equivalent. Tissue samples grading at presentation was: grade I (n=3), II (n=4), III (n=8), for histopathology were obtained post mortem by the case veter- IV (n=14) and V (n=1) 2013).
inarians in the remaining 25 cases. Renal histopathology was Abdominal ultrasonography ( performed by a European available for all 30 dogs and skin histopathology for 24 dogs. The diploma holder in Diagnostic Imaging in 11 dogs and a general most prominent histological changes were noted in the kidney practice veterinary surgeon in 2 dogs) revealed no evidence for and skin. For the kidney, the most striking changes involved the chronic kidney disease (CKD) or pyelectasia (n=13). The glomeruli, with frequent fibrinoid necrosis of glomerular arter- kidneys appeared unremarkable in eight dogs and the remaining ioles, characterised by distortion of vessel walls with an eosino- five had bilateral hyperechoic renal cortices. Three dogs had pos- philic, hyalinised, smudgy material, intermingled with low sible evidence for gastritis (thickened hypoechoic gastric rugal numbers of degenerate and viable neutrophils, fragmented red folds n=1; thickened hyperechoic rugal folds n=1; reduced blood cells and mild amounts of karyorrhectic debris ().
gastric wall layer definition n=1); one dog had hyperechoic Frequent vessels were occluded by thrombi. The majority of the small intestinal mucosal striations and thickening and uneven- glomeruli were affected and for individual glomeruli these ness of the colonic mucosa which may have suggested entero- changes ranged from mild and segmental to global and severe.
colitis. One additional dog had evidence for hepatopathy Also, frequent glomerular tufts were congested and partially (hypoechoic hepatic parenchyma with cuffing of the portal occluded by haemorrhage. Increased cellularity of the glomerular veins). No other relevant abnormalities were identified on tufts consistent with endothelial cell hypertrophy and swelling was identified in 17 cases. Fibrinoid necrosis of intralobular and Leptospirosis microscopic agglutination testing (MAT) was arcuate arteries was occasionally observed Twenty-nine performed in 15 cases. Ten had negative titres, obtained a dogs had concurrent evidence of tubular necrosis, ranging from median of three days (1–8 days) after the development of sys- mild to marked, often with concurrent evidence of tubular resti- temic signs. Five dogs had positive titres; their results and the tution. In affected kidneys, micro-organisms, viral cytopathic results of additional leptospirosis testing are summarised in effects and metazoan parasites were not identified. When per- FISH for Leptospires was performed on renal tissue from formed, Warthin-Starry stains did not reveal argyrophilic organ- seven dogs and liver tissue from one dog.vi A positive result was isms (Leptospires) within the tissue sections.
obtained from six renal samples; Leptospires were seen in small In the skin samples, the epidermis was focally to diffusely localised clusters in three dogs (one of whom had a negative ulcerated. The subjacent dermis was often undergoing coagula- MAT titre) and diffusely throughout the renal tissue in three tive necrosis. At the level of the adnexa, the hair follicles had dogs (one of whom was not tested for Leptospirosis by MAT).
reduced to absent sebaceous glands, reduced cellularity and were The remaining results were negative. Leptospirosis PCR was per- separated by increased fibrous tissue and an attenuated follicular formed on the renal tissue of three of the dogs with positive epithelium. The affected follicles were often bordered by variable FISH results; one dog had a negative result and one had a posi- numbers of neutrophils, foamy macrophages and karyorrhectic tive result; one dog had PCR performed at two laboratoriesvi vii debris ); this often obscured the follicular epithelium inter- and discordant results were obtained. Leptospirosis PCR was per- face and sebaceous gland units. In most cases, the deep dermis formed on liver tissue from one dogvi and the result was and subcutis were thickened by a layer of maturing fibrovascular tissue. Occasionally this fibrovascular tissue replaced portions ofthe adnexa. In a few cases (n=6), fibrinoid necrosis was observedin the small dermal arterioles Rarely, thrombi were iden-tified in such vessels. In one case, similar necro-ulcerative viUniversity of Bristol Veterinary Diagnostics.
changes were identified in skin from the lip. In samples from the oral cavity lesions, similar ulceration of the mucosa was observed 10.1136/vr.102892 Veterinary Record 5 of 12 TABLE 2: Selected data for the 30 confirmed cases Last available result Reference interval Platelet count (×109/l) Neutrophil count (×109/l) Creatinine (mmol/l) 40–106 mmol/l (13 dogs)44–159 mmol/l (16 dogs) Phosphate (mmol/l) 0.8–1.6 mmol/l (14 dogs)0.81–2.20 mmol/l (12 dogs) 0–25 U/L (10 dogs)10–100 U/L (15 dogs) 0–50 U/L (11 dogs)23–212 U/L (17 dogs) Total bilirubin (mmol/l) Potassium (mmol/l) Prothrombin time (seconds) No further results available Activated partial thromboplastin time (seconds) No further results available Urine specific gravity No further results available Urine protein: creatinine ratio No further results available Systolic blood pressure (mmHg) with associated necrosis, inflammation and fibrovascular change was identified in the tissue of one dog and a faint band in the of the submucosa.
other. Staphylococcaceae were identified in both samples. The The majority of other tissues evaluated (stomach, n=2; other laboratory identified solely Leptospires in both samples.
small intestine, n=6; colon, n=2; liver, n=14; pancreas, n=4; PCR for verotoxin 1 and 2, performed on the kidneys from heart, n=2; spleen, n=9; lung, n=1; brain, n=1; eye, n=1; saliv- four dogs, gave negative results. FISH for shiga toxin, performed ary gland, n=1; urinary bladder, n=3; tongue, n=2; soft palate, on the kidneys from six dogs, was also negative.
n=1; bone marrow, n=2; adrenal gland, n=2; tonsil, n=1; skel-etal muscle, n=1 and lymph node, n=2) appeared unremarkable, but occasionally exhibited mild, non-specific changes (see online Ten cases were managed at referral centres and 20 in primary supplementary appendix 1).
practice. Initial management typically consisted of intravenous Electron microscopy was performed in three dogs and fluid therapy (n=26) and antibiotic therapy (n=26) and is sum- revealed distension of the glomerular capillary loops by erythro- marised in Ten cases were managed with an indwelling cytes, occasional schistocytes and rare polymorphonuclear cells.
urinary catheter for measurement of urine output. Three cases Endothelial cells, when identifiable, were severely swollen.
underwent continuous renal replacement therapy.
Podocyte foot processes were globally effaced. Occasionally,mesangiolysis (dissolution of mesangium) was noted. Immunecomplexes were not identified. Immunostaining was negative for IgG, IgM, IgA, C3, C1q, kappa light chain (KLC) and lambda Twenty-four dogs died, or were euthanised, solely due to their light chain (LLC) disease and six were euthanised at the owners' request. IRIS AKI Renal tissue from two dogs was submitted to two separate grade progressed in 10 dogs, reduced in 2 and was unchanged in laboratories with both laboratories receiving both samples 12. Terminally, IRIS grades were: II (n=1), III (n=8), IV (n=13), (Department of Medical Microbiology and Immunology, School V (n=3) and unknown (n=5). Causes of death/euthanasia were: of Medicine, University of California, Davis, USA; University of oligoanuria (n=9), anaemia and thrombocytopaenia (n=2), pro- Bristol Veterinary Diagnostics, School of Veterinary Sciences, gressive azotaemia (n=6), unspecified clinical deterioration University of Bristol, Langford, Bristol, UK) for evaluation with (n=3), suspected DIC (n=1), dyspnoea (n=1), collapse (n=1), a broad spectrum set of 16S rRNA-directed probes (to detect bac- ascites (n=1) and owners' request due to concurrent disease(s), terial genetic material). From one laboratory, a clear 16S band financial constraints or concern regarding prognosis (n=6).
TABLE 3: Frequency of clinicopathological abnormalities Results for additional patients identified asdeveloping the abnormality during Results at presentation Number of patients Number of patients Reference interval Elevated serum urea concentration Elevated serum creatinine concentration (40–106 mmol/l 13 dogs;44–159 mmol/l, 16 dogs) 6 of 12 Veterinary Record 10.1136/vr.102892 Median time from onset of clinical signs to death or euthanasiawas seven days (1–16 days).
CRGV has been recognised in the USA for almost 30 years (), but has only sporadically beenreported in individual dogs elsewhere. This is the first case series of dogs with CRGV in the UK.
Most of the dogs in this case series were initially evaluated at their primary practice for a skin lesion (or lesions) which was considered consistent with pyoderma, pododermatitis, a bite/ sting, or a wound. Systemic signs developed a median of fourdays later, but some dogs were unwell concurrently. Initial inves- tigations revealed renal azotaemia attributable to AKI. Pre-renal causes were excluded via assessment of urine specific gravity, lack of response to intravenous fluid therapy and exclusion of hypoadrenocorticism. Abdominal imaging, where available, was used to exclude post-renal causes. CKD was excluded via a com-bination of clinical history and imaging findings. Eleven of the dogs (36.7 per cent) received NSAIDs before the diagnosis of AKI; although it is possible that their use exacerbated AKI, the histopathologic lesions were not consistent with NSAIDs beingthe sole cause of the AKI.
Other known causes of AKI were explored as thoroughly as possible in most of the dogs. Leptospirosis, which can cause similar clinical and laboratory signs to those seen in this caseseries (,, ), was furtherinvestigated with serology, PCR on peripheral blood, renal and hepatic tissue, and FISH on renal and hepatic tissue. The five dogs with positive Leptospirosis titres (1:100–1:800) had been vaccinated less than 1 year before testing and although vaccinal titres often decline by four months post-vaccination, they can sometimes persist for longer (leading to false-positive results. Additionally, only single titres above 1:1600are considered significant for indicating infection in vaccinated dogs (whereas the positive titre results obtained in the five dogs in this study were relatively low.
It is possible that the titres would have been higher if MAT testing had not been performed so early in the disease process.
Only 55 per cent of dogs with leptospirosis were diagnosed by a single MAT titre obtained within 72 hours of initial presentation in one study Convalescent phase samples could not, however, be obtained in the dogs in this study given the short survival time.
In cases of acute leptospirosis, histopathology often reveals mild renal tubular necrosis and interstitial oedema with focal areas of hepatic necrosis characterised by cellular disassociation of the hepatic cords This contrasts with the histopathological findings in this case series; no typical hepatic lesions were identified and the predominant renal lesion was TMA. Acute to peracute, peri- acinar hepatocellular loss with associated haemorrhage was observed in one dog in this series. This raised concern for lepto-spirosis, however, this case exhibited fibrinoid necrosis of small portal vessels, and consequently the periacinar changes may also have represented ischaemic change associated with the fibrinoid necrosis. In addition, both PCR and FISH on paraffin embedded sections of the affected liver were negative for Leptospira sp., making acute leptospirosis less likely. There was no evidence of argyrophilic Leptospires with silver staining, although this tech- nique can fail to identify Leptospires during acute leptospirosis (With the exception of calcinosis cutis, which was not identified in any dog in this series, skin lesions have not previously been reported in association with canine leptospirosis ).
FISH and PCR detected Leptospires in the renal tissues of some of the CRGV affected dogs reported in this series; however, this does not confirm clinical infection, as some dogs are asymp-tomatic maintenance hosts for Leptospires Although a causal relationship between leptospirosis and 10.1136/vr.102892 Veterinary Record 7 of 12

FIG 4: Photomicrographs of a glomerulus and an intralobular artery from a dog with CRGV, stained with haematoxylin and eosin [H&E] (a andc) and Masson's trichrome (b and d). There is fibrinoid vascular necrosis (asterisks) of intralobular arteries and arterioles. Glomerularcapillaries are severely distended and contain red blood cells, many of which are fragmented. Distension of glomerular capillaries is due todissolution of the mesangial matrix (mesangiolysis). Tubules are undergoing degeneration and necrosis; most tubules contain protein castswhereas some contain red blood cell casts.
CRGV cannot be fully excluded, the low number of positive Similarly, many breeds were represented in this case series. It is leptospirosis test results in this case series was felt unlikely to unclear at this time whether canine HUS and CRGV are truly support a diagnosis of acute leptospirosis as the clinical picture, two distinct disease processes. Dogs with CRGV typically outcome and histopathological findings differed significantly present with acute onset skin lesions affecting the distal limbs; from those previously reported with acute leptospirosis.
kidney injury and haematological abnormalities are variably Histopathologically, AKI in the dogs in this case series was reported In contrast skin lesions found to be attributable to TMA. A search of the International have not previously been reported in dogs with HUS Veterinary Renal Pathology Service database of more than 1000 renal biopsies from small animals, revealed TMA to account for ). The proportion of dogs in the UK that develop below 1 per cent of all diagnoses reached (Cianciolo R, unpub- CRGV without developing AKI is unknown at this stage; lished data). TMAs are characterised by inflammation and damage however, 42.9 per cent of dogs in contact with those reported in to vascular endothelium, leading to widespread formation of this study, developed skin lesions without biochemical evidence microthrombi, consumptive thrombocytopaenia, microangio- of AKI and it would have been interesting to review dermal and pathic haemolytic anaemia and multiorgan dysfunction ( renal histopathology in these dogs had it been available. Previous ). Five cases in this series (38.5 per cent of dogs in reports indicate that non-azotaemic dogs with CRGV tend to whom a blood smear was examined) had evidence for burr cells, have reduced glomerular filtration rates and renal histopathology schistocytes or acanthocytes; additionally 19 dogs were thrombo- showing mild, multifocal, endothelial glomerular changes cytopaenic and 13 dogs were hyperbilirubinaemic by the time of death. All of these findings can be the result of microangiopathy Clinicopathologic findings previously reported in dogs with CRGV include anaemia, thrombocytopaenia, azotaemia, high other mechanisms could also have been contributing to the serum liver enzyme activity, high muscle enzyme activity, anaemia, thrombocytopaenia and hyperbilirubinaemia.
Known differential diagnoses for canine TMA include CRGV ) and haemolytic uraemic syndrome the abnormalities identified in the dogs in this case series.
(HUS). HUS has previously been reported in five dogs Previous reports have not further classified the anaemia three cats (and a case series the anaemia appeared pre- or non-regenerative and number of other species the former was considered most likely. Possible aetiologies con- sidered included gastrointestinal haemorrhage secondary to ). CRGV has been almost exclusively reported in grey- uraemia or microangiopathic red cell injury. Hypoalbuminaemia hounds (, although (identified in 63.3 per cent of the confirmed cases in this series) there is one report of an affected Great Dane ( may support gastrointestinal haemorrhage, without excluding In contrast, HUS in dogs has been reported in a other possible causes.
variety of breeds: Yorkshire terrier, miniature poodle, Labrador Histopathological findings previously reported with CRGV retriever, German shepherd dog and boxer ( with those seen in this case series. The majority of the skin 8 of 12 Veterinary Record 10.1136/vr.102892

FIG 7: Electron micrograph of a glomerular capillary loop from a dogwith cutaneous and renal glomerular vasculopathy (CRGV). Thereare multiple deformed red blood cells (white asterisks) and swollenendothelial cells (black asterisks). A few small aggregates of fibrintactoids are present at the periphery of the capillary loop (arrows) Glomerular ultrastructural changes previously reported with FIG 5: Photomicrograph of a necrotic hair follicle with neutrophilic CRGV ) were similar to the changes identified in this case series. Immune complexes, complementand immunoglobulins have not previously been identified in the lesions in this case series, as in previous reports of CRGV, kidneys of dogs affected by CRGV , involved the distal extremities. This could be attributable to the and were not identified in this popula- increased number of smaller calibre vessels in this location and tion of UK dogs.
an increased propensity to infarction.
Microscopic lesions in abdominal organs other than the kidneys in dogs with CRGV were reported as being consistentwith uraemia and hypovolaemia in one report ( TABLE 5: Summary of case management ). Hyalinisation and rare thrombi were identified in the submucosa of the stomach, and small and large intestine inanother report (). Fibrinoid necrosis of smaller vessels was identified in this case series but thrombi were not identified in abdominal organs other than the kidney.
Route of antibiotic administration Other medications Corticosteroids (anti-inflammatory dose) Corticosteroids (immunosuppressive dose) Fresh frozen plasma FIG 6: Photomicrograph of a small dermal artery with fibrinoid CRRT, continuous renal replacement therapy necrosis of the vessel wall 10.1136/vr.102892 Veterinary Record 9 of 12 As discussed, canine TMAs can be the result of CRGVor HUS, considered unlikely in this case series: PCR, FISH and viral meta- which may represent two variants of the same disease with the genomics ( performed in an effort to detect any encapsulated same aetiology, or which may be two separate diseases. The most virus potentially present in kidney tissue) results were negative, common form of HUS in human beings, termed STEC-HUS or D and histopathologically there was no evidence of viral cytopathic +HUS, is associated with E. coli or Shigella dysenteriae shiga toxin effect (cytoplasmic inclusion bodies) in any of the tissues exam- ined. Negative results for viral metagenomics do not completely Co-infection with Salmonella or Campylobacter may exclude a viral aetiology, however. The results could indicate that also be important STEC-HUS typic- virus was present in low copy number, or that the virus was too ally starts with watery, then haemorrhagic, diarrhoea followed by remotely related to known viruses used for sequence alignment, thrombocytopaenia, haemolysis and azotaemia or that the sample used was too autolysed to preserve the virus.
). STEC-HUS appears a median The significance of the Staphylococcaceae detected by 16S of seven days after the onset of diarrhoea ( rRNA-directed probe in two dogs in this case series is unclear In this case series, a diarrhoeic prodrome was only reported in four but, contamination with commensal skin bacteria is considered dogs; however, if owners were not specifically questioned about more likely than disease-causing infection, as the kidneys were prodromal diarrhoea, this information may have been missed. In not kept sterile before the DNA extraction phase. The negative contrast, four of the five dogs previously reported with HUS had urine and renal tissue culture results obtained support this diarrhoeic prodromes , It is currently unknown if CRGV is a novel canine disease or E. coli shiga toxin has not been identified in dogs with HUS if it is a variant of HUS, aHUS or indeed one of the other TMA's reported in man. These include ‘HUS of unknown aetiology' and thrombotic thrombocytopaenic purpura (TTP) ). Shiga toxin has been identified in one horse ( ). Evaluation of the canine complement system may and two of three rabbits previously reported provide further information regarding the aetiology of CRGV.
with HUS Shiga toxin producing Management of human TMA's is dependent upon the under- E. coli, Salmonella and Campylobacter were not identified in the lying cause. Plasma therapy, antibiotic administration, monoclo- faeces or kidneys of dogs in this study. Reasons for failing to nal shiga toxin antibodies and renal transplantation have all identify toxin, or causative bacteria, may have included previous been used in STEC-HUS. A recombinant, anti-C5 antibody (ecu- antibiotic administration, inappropriate sample handling or late lizumab) is the treatment of choice for human aHUS ( collection of samples. In human beings, recovery of toxin- , ) but the cost has producing E. coli is highly dependent upon faecal culture being prohibited its evaluation in dogs. Plasma exchange remains the performed within six days of the onset of diarrhoea ( treatment of choice for human TTP and is a useful therapy for aHUS ().
In one case series of 18 dogs with CRGV in the USA, season- Monoclonal antibody therapy to CD20 and classical immuno- ality was reported as early winter and early summer ( suppressive drug therapy have also been reported for manage- in this case series, dogs presented over winter and ment of human TTP (). One dog with early spring. In contrast, STEC-HUS in people is more com- CRGV was reportedly ineffectively managed with immunosup- monly reported in the summer pressive therapy ). The efficacy of ). Seasonality of canine HUS has not been plasma therapy and monoclonal antibody therapy has yet to be reported (Any potential seasonal dis- evaluated in CRGV.
tribution of CRGV may become apparent with time, provided Case selection bias could have been introduced in this case disease surveillance continues.
series. Fifty one of the 53 practices involved identified cases Human STEC-HUS tends to occur either sporadically or in based on their awareness of CRGV and the presenting signs.
small geographical clusters (, Cases may have been missed in these practices without compre- ), which may be similar hensive searching of computerised record systems. The actual to the findings in this case series and epidemiological investiga- number of dogs affected by CRGV may therefore be higher than tions are ongoing. Although cases were reported from across the reported in this case series.
north and south of England, 36.7 per cent came from The New Six surviving dogs were strongly suspected, by the authors, Forest, Hampshire. This high percentage could, however, be to be suffering from CRGV. Renal histopathology was not avail- attributed to the geographical location of the primary investiga- able to confirm the diagnosis as, invasive procedures, like renal tors in Hampshire and increased awareness amongst local biopsy in patients with AKI showing apparent improvement to symptomatic management, are considered clinically difficult to In people, genetic or acquired conditions causing comple- justify. This may suggest that CRGV is not an invariably fatal ment dysregulation can cause another TMA, known as atypical HUS (aHUS) (Skin lesions have beenreported alongside haemolysis and AKI with aHUS (which isnot the case with STEC-HUS), but the incidence is rare Even in patients with multiple CRGV is a TMA of unknown aetiology which, when azotaemia genetic defects, aHUS may not develop until adulthood and an develops, currently appears to carry a grave prognosis.
environmental trigger is considered likely for the development of Vasculopathy, preferentially affecting the small vessels of the disease (). Atypical HUS has not been skin and kidneys in dogs, as identified in this case series, appears reported in dogs; however, CRGV may bear some resemblance to to be unique to CRGV and has not, to the authors' knowledge, this disease, especially given the concurrent findings of skin been reported associated with any other canine disease.
lesions and AKI identified in both diseases. An infectious or Although this case series provides useful initial information environmental trigger for CRGV may be suspected, given the about CRGV in the UK, the retrospective multicentre nature of number of in-contact dogs in this case series that developed skin the study is a limitation. Continued detailed clinical, clinico- lesions with or without AKI. It was also interesting to note that pathological and epidemiological evaluation will further enhance all of the affected in-contact dogs were related either to each the understanding of the disease and will hopefully help to iden- other and/or to a confirmed case.
tify possible triggers, define prognostic indicators and determine Dog Circovirus has recently been isolated from the tissues of the most appropriate management for these patients. The ques- dogs with vascular and granulomatous disease of unknown tion remains as to whether this is an emerging disease or, one origin (); however, a viral aetiology was that was previously present but unrecognised.
10 of 12 Veterinary Record 10.1136/vr.102892 DICKINSON, C. E., GOULD, D. H., DAVIDSON, A. H., AVERY, P. R., LEGARE, The authors would like to thank the following veterinary sur- M. E., HYATT, D. R. & DEBROY, C. (2008) Hemolytic-uremic syndrome in apostpartum mare concurrent with encephalopathy in the neonatal foal. geons: Roger Stobbs BVSc, MRCVS; Monica Augusto DVM CertSAM DipECVIM-CA MRCVS; Aran Mas DVM DipECVIM- EUBIG, P. A., BRADY, M. S., KHAN, S. A., MAZZAFERRO, E. M. & MORROW, CA MRCVS; Fabio Procoli DMV, MVetMed, DACVIM, C. M. K. (2005) Acute renal failure in dogs after the ingestion of grapes or raisins: DECVIM-CA, MRCVS; Stephen C B Perkins BVSc, BSc, a retrospective evaluation of 43 dogs (1992–2002). Journal of Veterinary InternalMedicine 19, 663–674 MRCVS; Louise Ketteridge BVetMed, MRCVS; Ken C Smith FERRER, L., RABANAL, R., FONDEVILA, D., RAMOS, J. A. & DOMINGO, M. (1988) Skin lesions in canine leishmaniasis. 29, 381–388 Harrington BSc Vet Path, MVB, MVetMed, DipACVP, MRCVS; FISCHER, J. R., LANE, I. F. & STOKES, J. (2009) Acute postrenal azotaemia: eti- Nicholas G A Woodger BVetMed, BSc, MRCVS; Clare James ology, clinicopathology, and pathophysiology. Compendium: Continuing Educationfor Veterinarians 31, 520–530 BVSc, BSc, DipACVP, MRCVS; Kerstin Baiker Dr med vet, FOURNEL, C., CHABANNE, L., CAUX, C., FAURE, J. R., RIGAL, D., MAGNOL, DVM, DiplECVP; Kerstin Erles DrMedVet, FRCPath, MRCVS; J. P. & MONIER, J. C. (1992) Canine systemic lupus erythematosus. I: a study of Stefanie B Gobelli Dr med vet, FVH; Isabelle Brodard; Darren J 75 cases. 1, 133–139 Lucas VetMB, MA, MRCVS; Edward M Roberts BVetMed, GARCIA, A., MARINI, R. P., FENG, Y., VITSKY, A., KNOX, K. A., TAYLOR, N. S., MRCVS; Roisin Dickinson BVetMed, MRCVS; Tara C Zilic SCAUER, D. B. & FOX, J. G. (2002) A naturally occurring rabbit model of entero-hemorrhagic Escherichia coli-induced disease. 186, BVetMed, MRCVS; Louise C Melling BVetMed, MRCVS; and Kobus Engelbrecht BVSc, MRCVS along with all of the other GOLDFARB, S. & ADLER, S. H. (2001) Acute renal failure: pathophysiology and veterinary surgeons who very kindly submitted clinical records treatment. Nephrology 4, 1–12 and samples for histopathology to Anderson Moores Veterinary GREENE, C. E., SYKES, J. E., BROWN, C. A. & HARTMAN, K. (2006) Leptospirosis. In Infectious Diseases of the Dog and Cat. 3rd edn. Ed. C. E. GREENE.
Specialists. The authors would also like to thank owners of Saunders Elsevier Inc. Chapter 44. pp 402–417 affected dogs, owners that returned questionnaires, and the New HENDRICKS, A. (2000) Akute Ulzerative Dermatitis Bei Einem Greyhound.
Forest District Council, Forestry Commission, New Forest Dog Proceedings of the 46th Annual Congress of the Small Animal Veterinary Association, Owners Group and Anderson Moores Veterinary Specialists who Dusseldorf, Germany. pp 62–63 HERTZKE, D. M., COWAN, L. A., SCHONING, P. & FENWICK, B. W. (1995) provided funding for diagnostic testing. The authors would also Glomerular Ultrastructural Lesions of Idiopathic Cutaneous and Renal like to thank Dr Paul S Bass BSc MD FRCPath for his valuable Glomerular Vasculopathy of Greyhounds. 32, 451–459 insights regarding the renal histopathology.
HOLLOWAY, S., SENIOR, D., ROTH, L. & TISHER, C. C. (1993) Hemolytic uremic syndrome in dogs. 7, 220–227 ▸ Additional material is available. To view please visit the journal KAVANAGH, D., GOODSHIP, T. H. & RICHARDS, A. (2013) Atypical hemolytic uremic syndrome. 33, 508–530 LI, L., MCGRAW, S., ZHU, K., LEUTENEGGER, C. M., MARKS, S. L., KUBISKI, S., GAFFNEY, P., DELA CRUZ, F. N. Jr, WANG, C., DELWART, E. & PESAVENTO, Open Access This is an Open Access article distributed in accordance with the P. A. (2013) Circovirus in tissues of dogs with vasculitis and hemorrhage.
Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license MILFORD, D. V., TAYLOR, C. M., GUTTRIDGE, B., HALL, S. M., ROWE, B. & KLEANTHOUS, H. (1990) Haemolytic uraemic syndromes in the British Isles their derivative works on different terms, provided the original work is properly cited 1985–8: association with Verocytotoxin producing Escherichia coli. Part 1: clinical and the use is non-commercial. See: and epidemiological aspects. 65, 716–721 MONAHAN, A. M., CALLANAN, J. J. & NALLY, J. E. (2009) Review paper: host-pathogen interactions in the kidney during chronic leptospirosis. 46, 792–799 MOORE, P. F., OLIVRY, T. & NAYDAN, D. (1994) Canine cutaneous epithelio- ARDISSINO, G., POSSENTI, I., SALARDI, S., TEL, F., COLOMBO, E., TESTA, S., trophic lymphoma (mycosis fungoides) is a proliferative disorder of CD8+ T DAPRAI, L., PICICCO, D., COLOMBO, R. M. & TORRESANI, E. (2014a) cells. American Journal of Pathology 144, 421–429 Co-infection in children with bloody diarrhea caused by Shigatoxin-producing MORRIS, C. F., ROBERTSON, J. L., MANN, P. C., CLARK, S. & DIVERS, T. J.
Escherichia coli: data of the North Italian HUS network. (1987) Hemolytic uremic-like syndrome in two horses. Journal of the American Veterinary Medical Association 191, 1453–1454 ARDISSINO, G., TEL, F., TESTA, S., MARZANO, A. V., LAZZARI, R., SALARDI, MUNDAY, J. S., BERGEN, D. J. & ROE, W. D. (2005) Generalised calcinosis cutis S. & EDEFONTI, A. (2014b) Skin involvement in atypical hemolytic uremic syn- associated with probable leptospirosis in a dog. 16, 401–406 drome. 63, 652–655 NORIS, M., MESCIA, F. & REMUZZI, G. (2012) STEC-HUS, atypical HUS and TTP ARONSON, L. R. & GREGORY, C. (1999) Possible hemolytic uremic syndrome in are all diseases of complement activation. 8, 622–633 three cats after renal transplantation and cyclosporine therapy. PASS, M. A., ODEDRA, R. & BATT, R. M. (2000) Multiplex PCRs for identification of Escherichia coli virulence genes. Journal of Clinical Microbiology 38, 2001–2004 BIRNBAUM, N., BARR, S. C., CENTER, S. A., SCHERMERHORN, T., REBAR, A. H., LEWIS, H. B., DENICOLA, D. B., HALLIWELL, W. H. & BOON, RANDOLPH, J. F. & SIMPSON, K. W. (1998) Naturally acquired Leptospirosis in G. D. (1981) Red cell fragmentation in the dog: an editorial review. Veterinary 36 dogs: serological and clinicopathological features. Pathology 18, 415–426 RENTKO, V. T., CLARK, N., ROSS, L. A. & SCHELLING, S. H. (1992) Canine BLOMBERY, P. & SCULLY, M. (2014) Management of thrombotic thrombocytope- leptospirosis. A retrospective study of 17 cases. nic purpura: current perspectives. Journal of Blood Medicine 5, 15–23 BOURHY, P., BREMONT, S., ZININI, F., GIRY, C. & PICARDEAU, M. (2011) ROBY, K. A. W., BLOOM, J. C. & BECHT, J. L. (1987) Postpartum hemolytic-uremic Comparison of real-time PCR assays for detection of pathogenic Leptospira spp.
syndrome in a cow. Journal of the American Veterinary Medical Association 190, 187–190 in blood and identification of variations in target sequences. ROTERMUND, A., PETERS, M., HEWICKER-TRAUTWEIN, M. & NOLTE, I.
(2002) Cutaneous and renal glomerular vasculopathy in a Great Dane resembling BOYCE, T. G., SWERDLOW, D. L. & GRIFFIN, P. M. (1995) Escherichia coli 0157:H7 ‘Alabama rot' of greyhounds. 151, 510–512 and the hemolytic-uremic syndrome. 333, RUGGENENTI, P., NORIS, M. & REMUZZI, G. (2001) Thrombotic microangiopa- thy, hemolytic uremic syndrome, and thrombotic thrombocytopenic purpura.
BURNENS, A. P., FREY, A., LIOR, H. & NICOLET, J. (1995) Prevalence and clinical significance of vero-cytotoxin-producing Escherichia coli (VTEC) isolated from SALVADORI, M. & BERTONI, E. (2013) Update on hemolytic uremic syndrome: cattle in herds with and without calf diarrhoea. Zentralblatt fur Veterinarmedizin diagnostic and therapeutic recommendations. 2, 56–76 ( Journal of Veterinary Medicine) series B 42, 311–318 SYKES, J. E., HARTMANN, K., LUNN, K. F., MOORE, G. E., STODDARD, R. A.
CARPENTER, J. L., ANDELMAN, N. C., MOORE, F. M. & KING, N. W. Jr (1988) & GOLDSTEIN, R. E. (2011) 2010 ACVIM Small animal consensus statement on Idiopathic cutaneous and renal glomerular vasculopathy of greyhounds.
leptospirosis: diagnosis, epidemiology, treatment and prevention. CHANTREY, J., CHAPMAN, P. S. & PATTERSON-KANE, J. C. (2002) Haemolytic- TANGEMAN, L. E. & LITTMAN, M. P. (2013) Clinicopathologic and atypical fea- uraemic syndrome in a dog. 49, 470–472 tures of naturally occurring leptospirosis in dogs: 51 cases (2000–2010). COWAN, L. A., HERTZKE, D. M., FENWICK, B. W. & ANDREASEN, C. B. (1997) Clinical and clinicopathologic abnormalities in greyhounds with cutaneous and TARR, P. I., GORDON, C. A. & CHANDLER, W. L. (2005) Shiga-toxin-producing renal glomerular vasculopathy: 18 cases (1992–1994). Journal of the American Escherichia coli and haemolytic uraemic syndrome. Lancet 365, 1073–1086 Veterinary Medical Association 210, 789–793 TARR, P. I., NEILL, M. A., CLAUSEN, C. R., WATKINS, S. L., CHRISTIE, D. L. & DELL'ORCO, M., BERTAZZOLO, W., PAGLIARO, L., ROCCABIANCA, P. & HICKMAN, R. O. (1990) Escherichia coli 0157:H7 and the hemolytic uremic syn- COMAZZI, S. (2005) Hemolytic-uremic syndrome in a dog. drome: importance of early cultures in establishing the etiology. 10.1136/vr.102892 Veterinary Record 11 of 12

UCHIDA, H., KIYOKAWA, N., HORIE, H., FUJIMOTO, J. & TAKEDA, T. (1999) VICTORIA, J. G., KAPOOR, A., LI, L., BLINKOVA, O., SLIKAS, B. & WANG, C.
The detection of shiga toxins in the kidney of a patient with hemolytic uremic (2009) Metagenomic analyses of viruses in stool samples from children with syndrome. 45, 133–137 acute flaccid paralysis. 83, 4642–4651 VAN DEN INGH T. S. G. A. M., VAN WINKLE T., CULLEN J M., CHARLES J A. & WAIKAR, S. S., LIU, K. D. & CHERTOW, G. M. (2008) Diagnosis, epidemiology DESMET V. J. (2006). Morphological Classification of Parenchymal Disorders of and outcomes of acute kidney injury. the Canine and Feline Liver. In: ROTHUIZEN J., BUNCH S. E., CHARLES J. A., et al. Chronic Hepatitis. WSAVA Standards for Clinical and Histological Diagnosis of WALKER, D. & MCMAHON, L. (2013) Acute kidney injury in dogs. Canine and Feline Liver Diseases. Philadelphia PA: Saunders Elsevier Ltd. Chapter 7. pp, 93-95.
VAN DEN INGH, T. S. G. A. M., VAN WINKLE, T., CULLEN, J. M., CHARLES, J. A. & DESMET, V. J. (2006) Morphological classification of parenchymal disor-ders of the canine and feline liver. WSAVA Standards for Clinical and HistologicalDiagnosis of Canine and Feline Liver Diseases 93–95 12 of 12 Veterinary Record 10.1136/vr.102892 Cutaneous and renal glomerular
vasculopathy as a cause of acute kidney
injury in dogs in the UK
L. P. Holm, I. Hawkins, C. Robin, R. J. Newton, R. Jepson, G. Stanzani,
L. A. McMahon, P. Pesavento, T. Carr, T. Cogan, C. G. Couto, R.
Cianciolo and D. J. Walker
published online March 23, 2015 Veterinary Record Updated information and services can be found at: These include: Supplementary Supplementary material can be found at:
This article cites 44 articles, 15 of which you can access for free at: Open Access
This is an Open Access article distributed in accordance with the CreativeCommons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this worknon-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use isnon-commercial. See: Receive free email alerts when new articles cite this article. Sign up in the box at the top right corner of the online article. Articles on similar topics can be found in the following collections To request permissions go to: To order reprints go to: To subscribe to BMJ go to:

Source: http://alabamarot.co.uk/wp-content/uploads/2015/03/Veterinary-Record-2015-Holm-vr.102892.pdf